Regulon of IscR in Tolumonas auensis DSM 9187

Properties
Regulator type:	Transcription factor
TF locus tag:	Tola_2020
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -94 Score: 7 Sequence: ATACTTGAACTGTTTAGTCAGGTAT Locus tag: Tola_0580 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Tola_0580	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -56 Score: 6.1 Sequence: ATACTTGACTGAAAAAGTAGGACAT Locus tag: Tola_2020 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Tola_2019 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Tola_2018 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Tola_2017 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Tola_2016 Name: hscB Funciton: Chaperone protein HscB Locus tag: Tola_2015 Name: hscA Funciton: Chaperone protein HscA Locus tag: Tola_2014 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Tola_2020	iscR	Iron-sulfur cluster regulator IscR
	Tola_2019	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Tola_2018	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Tola_2017	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Tola_2016	hscB	Chaperone protein HscB
	Tola_2015	hscA	Chaperone protein HscA
	Tola_2014	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD