Regulon of IscR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_2613
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 7.4 Sequence: ATACTTGACTGTTTTAGTCGGGTAT Locus tag: ASA_2613 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ASA_2612 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ASA_2611 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: ASA_2610 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: ASA_2609 Name: ASA_2609 Funciton: Hypothetical protein Locus tag: ASA_2608 Name: hscB Funciton: Chaperone protein HscB Locus tag: ASA_2607 Name: hscA Funciton: Chaperone protein HscA Locus tag: ASA_2606 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	ASA_2613	iscR	Iron-sulfur cluster regulator IscR
	ASA_2612	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	ASA_2611	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	ASA_2610	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	ASA_2609	ASA_2609	Hypothetical protein
	ASA_2608	hscB	Chaperone protein HscB
	ASA_2607	hscA	Chaperone protein HscA
	ASA_2606	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -78 Score: 6.9 Sequence: ATACTTGAACTAAACAGTCGGGTAT Locus tag: ASA_0800 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	ASA_0800	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD