Regulog Zur - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | 4 | 3 |
| Xanthomonas axonopodis pv. citri str. 306 | 5 | 4 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 5 | 4 |
| Stenotrophomonas maltophilia K279a | 3 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| omr1 |
*
Xylella fastidiosa 9a5c Site: position = -122 score = 4.68153 sequence = TGAATGATATAATATTACCTTAC Gene: XF0384: predicted zinc-related TonB-dependent outer membrane transporter |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -138 score = 5.4432 sequence = GACGTGGAATAATATAACATCTT Gene: XAC2829: predicted zinc-related TonB-dependent outer membrane transporter |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -138 score = 5.4432 sequence = GACGTGGAATAATATAACATCTT Gene: XCC2658: predicted zinc-related TonB-dependent outer membrane transporter |
*
Stenotrophomonas maltophilia K279a Site: position = -111 score = 5.59306 sequence = GTTATGGAATAATATAACATCCC Gene: Smlt1446: predicted zinc-related TonB-dependent outer membrane transporter |
predicted zinc-related TonB-dependent outer membrane transporter |
| CRON 2. | |||||
| omr2 |
|
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -63 score = 5.23497 sequence = AGTATGTTATAACATGTCATTTC Gene: XAC0690: predicted zinc-related TonB-dependent outer membrane transporter |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -56 score = 4.67018 sequence = ATTACGTTATAATATATCGATAC Gene: XCC2046: predicted zinc-related TonB-dependent outer membrane transporter |
*
Stenotrophomonas maltophilia K279a Site: position = -42 score = 6.13482 sequence = GAAATGTTATATGATTACATTTC Gene: Smlt0157: predicted zinc-related TonB-dependent outer membrane transporter |
predicted zinc-related TonB-dependent outer membrane transporter |
| CRON 3. | |||||
| folE2 |
*
Xylella fastidiosa 9a5c Site: position = -196 score = 5.67705 sequence = GTTATGTTATTTTATAACATATT Gene: XF2096: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
Gene: XAC1781: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
Gene: XCC1764: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
|
GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
| can |
Gene: XF2095: Carbonic anhydrase, gamma class (EC 4.2.1.1) |
|
|
|
Carbonic anhydrase, gamma class (EC 4.2.1.1) |
| amiC |
|
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -153 score = 5.7151 sequence = TTGATGTTACTTTATAACACTTG Gene: XAC1780: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -152 score = 5.54637 sequence = CTAGTGTTACTTTATAACACTTG Gene: XCC1763: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
|
N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
| CRON 4. | |||||
| yciC |
*
Xylella fastidiosa 9a5c Site: position = -108 score = 4.21914 sequence = AGAATGATATAAAGTATCAAATT Gene: XF1830: Putative zinc chaperone, COG0523 family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -43 score = 5.69164 sequence = TAAGTGTTATATAGTAACACTCC Gene: XAC0276: Putative zinc chaperone, COG0523 family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -41 score = 5.56421 sequence = GAGTTGTTATACAGTAACATTTC Gene: XCC0257: Putative zinc chaperone, COG0523 family |
*
Stenotrophomonas maltophilia K279a Site: position = -48 score = 5.51917 sequence = TAAGTGTTATACAGTAACATTCC Gene: Smlt0520: Putative zinc chaperone, COG0523 family |
Putative zinc chaperone, COG0523 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |