Statistics of regulated genes

Genome	Genes	Operons
Xylella fastidiosa 9a5c	4	3
Xanthomonas axonopodis pv. citri str. 306	5	4
Xanthomonas campestris pv. campestris str. ATCC 33913	5	4
Stenotrophomonas maltophilia K279a	3	3

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
omr1	* Xylella fastidiosa 9a5c Site: position = -122 score = 4.68153 sequence = TGAATGATATAATATTACCTTAC Gene: XF0384: predicted zinc-related TonB-dependent outer membrane transporter	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -138 score = 5.4432 sequence = GACGTGGAATAATATAACATCTT Gene: XAC2829: predicted zinc-related TonB-dependent outer membrane transporter	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -138 score = 5.4432 sequence = GACGTGGAATAATATAACATCTT Gene: XCC2658: predicted zinc-related TonB-dependent outer membrane transporter	* Stenotrophomonas maltophilia K279a Site: position = -111 score = 5.59306 sequence = GTTATGGAATAATATAACATCCC Gene: Smlt1446: predicted zinc-related TonB-dependent outer membrane transporter	predicted zinc-related TonB-dependent outer membrane transporter
CRON 2.
omr2	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -63 score = 5.23497 sequence = AGTATGTTATAACATGTCATTTC Gene: XAC0690: predicted zinc-related TonB-dependent outer membrane transporter	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -56 score = 4.67018 sequence = ATTACGTTATAATATATCGATAC Gene: XCC2046: predicted zinc-related TonB-dependent outer membrane transporter	* Stenotrophomonas maltophilia K279a Site: position = -42 score = 6.13482 sequence = GAAATGTTATATGATTACATTTC Gene: Smlt0157: predicted zinc-related TonB-dependent outer membrane transporter	predicted zinc-related TonB-dependent outer membrane transporter
CRON 3.
folE2	* Xylella fastidiosa 9a5c Site: position = -196 score = 5.67705 sequence = GTTATGTTATTTTATAACATATT Gene: XF2096: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1781: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1764: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Stenotrophomonas maltophilia K279a	GTP cyclohydrolase I (EC 3.5.4.16) type 2
can	Xylella fastidiosa 9a5c Gene: XF2095: Carbonic anhydrase, gamma class (EC 4.2.1.1)	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a	Carbonic anhydrase, gamma class (EC 4.2.1.1)
amiC	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -153 score = 5.7151 sequence = TTGATGTTACTTTATAACACTTG Gene: XAC1780: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -152 score = 5.54637 sequence = CTAGTGTTACTTTATAACACTTG Gene: XCC1763: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	Stenotrophomonas maltophilia K279a	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
CRON 4.
yciC	* Xylella fastidiosa 9a5c Site: position = -108 score = 4.21914 sequence = AGAATGATATAAAGTATCAAATT Gene: XF1830: Putative zinc chaperone, COG0523 family	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -43 score = 5.69164 sequence = TAAGTGTTATATAGTAACACTCC Gene: XAC0276: Putative zinc chaperone, COG0523 family	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -41 score = 5.56421 sequence = GAGTTGTTATACAGTAACATTTC Gene: XCC0257: Putative zinc chaperone, COG0523 family	* Stenotrophomonas maltophilia K279a Site: position = -48 score = 5.51917 sequence = TAAGTGTTATACAGTAACATTCC Gene: Smlt0520: Putative zinc chaperone, COG0523 family	Putative zinc chaperone, COG0523 family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD