Regulon of Zur in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt1442
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 5.5 Sequence: TAAGTGTTATACAGTAACATTCC Locus tag: Smlt0520 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	Smlt0520	yciC	Putative zinc chaperone, COG0523 family
Position: -42 Score: 6.1 Sequence: GAAATGTTATATGATTACATTTC Locus tag: Smlt0157 Name: omr2 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	Smlt0157	omr2	predicted zinc-related TonB-dependent outer membrane transporter
Position: -111 Score: 5.6 Sequence: GTTATGGAATAATATAACATCCC Locus tag: Smlt1446 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	Smlt1446	omr1	predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD