Regulon of Zur in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC2685
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Xanthomonadales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.6 Sequence: GAGTTGTTATACAGTAACATTTC Locus tag: XCC0257 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	XCC0257	yciC	Putative zinc chaperone, COG0523 family
Position: -56 Score: 4.7 Sequence: ATTACGTTATAATATATCGATAC Locus tag: XCC2046 Name: omr2 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	XCC2046	omr2	predicted zinc-related TonB-dependent outer membrane transporter
Position: -138 Score: 5.4 Sequence: GACGTGGAATAATATAACATCTT Locus tag: XCC2658 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	XCC2658	omr1	predicted zinc-related TonB-dependent outer membrane transporter
Position: -152 Score: 5.5 Sequence: CTAGTGTTACTTTATAACACTTG Locus tag: XCC1763 Name: amiC Funciton: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) Locus tag: XCC1764 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	XCC1763	amiC	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
	XCC1764	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD