Regulon of Zur in Xylella fastidiosa 9a5c

Properties
Regulator type:	Transcription factor
TF locus tag:	XF0821
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Xanthomonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 4.2 Sequence: AGAATGATATAAAGTATCAAATT Locus tag: XF1830 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	XF1830	yciC	Putative zinc chaperone, COG0523 family
Position: -122 Score: 4.7 Sequence: TGAATGATATAATATTACCTTAC Locus tag: XF0384 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	XF0384	omr1	predicted zinc-related TonB-dependent outer membrane transporter
Position: -196 Score: 5.7 Sequence: GTTATGTTATTTTATAACATATT Locus tag: XF2096 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: XF2095 Name: can Funciton: Carbonic anhydrase, gamma class (EC 4.2.1.1)
	XF2096	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	XF2095	can	Carbonic anhydrase, gamma class (EC 4.2.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD