Regulon of Zur in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC2846
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Xanthomonadales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.7 Sequence: TAAGTGTTATATAGTAACACTCC Locus tag: XAC0276 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	XAC0276	yciC	Putative zinc chaperone, COG0523 family
Position: -63 Score: 5.2 Sequence: AGTATGTTATAACATGTCATTTC Locus tag: XAC0690 Name: omr2 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	XAC0690	omr2	predicted zinc-related TonB-dependent outer membrane transporter
Position: -138 Score: 5.4 Sequence: GACGTGGAATAATATAACATCTT Locus tag: XAC2829 Name: omr1 Funciton: predicted zinc-related TonB-dependent outer membrane transporter
	XAC2829	omr1	predicted zinc-related TonB-dependent outer membrane transporter
Position: -153 Score: 5.7 Sequence: TTGATGTTACTTTATAACACTTG Locus tag: XAC1780 Name: amiC Funciton: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) Locus tag: XAC1781 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	XAC1780	amiC	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
	XAC1781	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD