Statistics of regulated genes

Genome	Genes	Operons
Thermotoga maritima MSB8	4	1
Thermotoga sp. RQ2	4	1
Thermotoga neapolitana DSM 4359	1	1
Thermotoga petrophila RKU-1	4	1
Thermotoga naphthophila RKU-10	4	1
Thermotoga lettingae TMO	3	1
Thermosipho africanus TCF52B	1	1
Thermosipho melanesiensis BI429	5	1
Fervidobacterium nodosum Rt17-B1	4	1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes												Function
CRON 1.
TM0766	* Thermotoga maritima MSB8 Site: position = -36 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: TM0766: hypothetical regulator TM0766, GntR family	* Thermotoga sp. RQ2 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: TRQ2_0160: hypothetical regulator TM0766, GntR family	* Thermotoga neapolitana DSM 4359 Site: position = 66 score = 7.16539 sequence = gTGTAATAgTAcAATATTACAG Gene: CTN_1811: hypothetical regulator TM0766, GntR family	* Thermotoga petrophila RKU-1 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: Tpet_0162: hypothetical regulator TM0766, GntR family	* Thermotoga naphthophila RKU-10 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: Tnap_0564: hypothetical regulator TM0766, GntR family	* Thermotoga lettingae TMO Site: position = -37 score = 6.70516 sequence = CTGTAATGTTGTAGTATTACAG Gene: Tlet_1559: hypothetical regulator TM0766, GntR family	* Thermosipho africanus TCF52B Site: position = -38 score = 7.57087 sequence = CTGTAATATTATAATATTACAG Gene: THA_1439: hypothetical regulator TM0766, GntR family	* Thermosipho melanesiensis BI429 Site: position = -54 score = 7.52062 sequence = CTGTAATAGTATAATATTACAG Gene: Tmel_1133: hypothetical regulator TM0766, GntR family	* Fervidobacterium nodosum Rt17-B1 Site: position = -68 score = 7.29939 sequence = CTGTAATAGTACAATATTACAG Gene: Fnod_0429: hypothetical regulator TM0766, GntR family	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0154: hypothetical regulator TM0766, GntR family	hypothetical regulator TM0766, GntR family
TM0765	Thermotoga maritima MSB8 Gene: TM0765: hypothetical ABC transporter, ATP-binding protein	Thermotoga sp. RQ2 Gene: TRQ2_0161: hypothetical ABC transporter, ATP-binding protein	Thermotoga neapolitana DSM 4359 Gene: CTN_1812: hypothetical ABC transporter, ATP-binding protein	Thermotoga petrophila RKU-1 Gene: Tpet_0163: hypothetical ABC transporter, ATP-binding protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0563: hypothetical ABC transporter, ATP-binding protein	Thermotoga lettingae TMO Gene: Tlet_1560: hypothetical ABC transporter, ATP-binding protein	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429 Gene: Tmel_1132: hypothetical ABC transporter, ATP-binding protein	Fervidobacterium nodosum Rt17-B1 Gene: Fnod_0428: hypothetical ABC transporter, ATP-binding protein	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0153: hypothetical ABC transporter, ATP-binding protein	hypothetical ABC transporter, ATP-binding protein
TM0764	Thermotoga maritima MSB8 Gene: TM0764: Hypothetical ABC transporter, permease protein	Thermotoga sp. RQ2 Gene: TRQ2_0162: Hypothetical ABC transporter, permease protein	Thermotoga neapolitana DSM 4359 Gene: CTN_1815: Hypothetical ABC transporter, permease protein	Thermotoga petrophila RKU-1 Gene: Tpet_0164: Hypothetical ABC transporter, permease protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0562: Hypothetical ABC transporter, permease protein	Thermotoga lettingae TMO Gene: Tlet_1561: Hypothetical ABC transporter, permease protein	Thermosipho africanus TCF52B Gene: THA_1437: Hypothetical ABC transporter, permease protein	Thermosipho melanesiensis BI429 Gene: Tmel_1131: Hypothetical ABC transporter, permease protein	Fervidobacterium nodosum Rt17-B1 Gene: Fnod_0427: Hypothetical ABC transporter, permease protein	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1 Gene: Kole_0155: Hypothetical ABC transporter, permease protein	Hypothetical ABC transporter, permease protein
THA_1435	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429 Gene: Tmel_1130: hypothetical protein	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	hypothetical protein
TM0763	Thermotoga maritima MSB8 Gene: TM0763: protein of unknown function DUF74	Thermotoga sp. RQ2 Gene: TRQ2_0163: protein of unknown function DUF74	Thermotoga neapolitana DSM 4359 Gene: CTN_1816: protein of unknown function DUF74	Thermotoga petrophila RKU-1 Gene: Tpet_0165: protein of unknown function DUF74	Thermotoga naphthophila RKU-10 Gene: Tnap_0561: protein of unknown function DUF74	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429 Gene: Tmel_1129: protein of unknown function DUF74	Fervidobacterium nodosum Rt17-B1 Gene: Fnod_0426: protein of unknown function DUF74	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	protein of unknown function DUF74

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD