Regulog TM0766 - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 4 | 1 |
| Thermotoga sp. RQ2 | 4 | 1 |
| Thermotoga neapolitana DSM 4359 | 1 | 1 |
| Thermotoga petrophila RKU-1 | 4 | 1 |
| Thermotoga naphthophila RKU-10 | 4 | 1 |
| Thermotoga lettingae TMO | 3 | 1 |
| Thermosipho africanus TCF52B | 1 | 1 |
| Thermosipho melanesiensis BI429 | 5 | 1 |
| Fervidobacterium nodosum Rt17-B1 | 4 | 1 |
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| TM0766 |
*
Thermotoga maritima MSB8 Site: position = -36 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: TM0766: hypothetical regulator TM0766, GntR family |
*
Thermotoga sp. RQ2 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: TRQ2_0160: hypothetical regulator TM0766, GntR family |
*
Thermotoga neapolitana DSM 4359 Site: position = 66 score = 7.16539 sequence = gTGTAATAgTAcAATATTACAG Gene: CTN_1811: hypothetical regulator TM0766, GntR family |
*
Thermotoga petrophila RKU-1 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: Tpet_0162: hypothetical regulator TM0766, GntR family |
*
Thermotoga naphthophila RKU-10 Site: position = -35 score = 7.38661 sequence = GTGTAATAGTATAATATTACAG Gene: Tnap_0564: hypothetical regulator TM0766, GntR family |
*
Thermotoga lettingae TMO Site: position = -37 score = 6.70516 sequence = CTGTAATGTTGTAGTATTACAG Gene: Tlet_1559: hypothetical regulator TM0766, GntR family |
*
Thermosipho africanus TCF52B Site: position = -38 score = 7.57087 sequence = CTGTAATATTATAATATTACAG Gene: THA_1439: hypothetical regulator TM0766, GntR family |
*
Thermosipho melanesiensis BI429 Site: position = -54 score = 7.52062 sequence = CTGTAATAGTATAATATTACAG Gene: Tmel_1133: hypothetical regulator TM0766, GntR family |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -68 score = 7.29939 sequence = CTGTAATAGTACAATATTACAG Gene: Fnod_0429: hypothetical regulator TM0766, GntR family |
|
Gene: Kole_0154: hypothetical regulator TM0766, GntR family |
hypothetical regulator TM0766, GntR family |
| TM0765 |
Gene: TM0765: hypothetical ABC transporter, ATP-binding protein |
Gene: TRQ2_0161: hypothetical ABC transporter, ATP-binding protein |
Gene: CTN_1812: hypothetical ABC transporter, ATP-binding protein |
Gene: Tpet_0163: hypothetical ABC transporter, ATP-binding protein |
Gene: Tnap_0563: hypothetical ABC transporter, ATP-binding protein |
Gene: Tlet_1560: hypothetical ABC transporter, ATP-binding protein |
|
Gene: Tmel_1132: hypothetical ABC transporter, ATP-binding protein |
Gene: Fnod_0428: hypothetical ABC transporter, ATP-binding protein |
|
Gene: Kole_0153: hypothetical ABC transporter, ATP-binding protein |
hypothetical ABC transporter, ATP-binding protein |
| TM0764 |
Gene: TM0764: Hypothetical ABC transporter, permease protein |
Gene: TRQ2_0162: Hypothetical ABC transporter, permease protein |
Gene: CTN_1815: Hypothetical ABC transporter, permease protein |
Gene: Tpet_0164: Hypothetical ABC transporter, permease protein |
Gene: Tnap_0562: Hypothetical ABC transporter, permease protein |
Gene: Tlet_1561: Hypothetical ABC transporter, permease protein |
Gene: THA_1437: Hypothetical ABC transporter, permease protein |
Gene: Tmel_1131: Hypothetical ABC transporter, permease protein |
Gene: Fnod_0427: Hypothetical ABC transporter, permease protein |
|
Gene: Kole_0155: Hypothetical ABC transporter, permease protein |
Hypothetical ABC transporter, permease protein |
| THA_1435 |
|
|
|
|
|
|
|
Gene: Tmel_1130: hypothetical protein |
|
|
|
hypothetical protein |
| TM0763 |
Gene: TM0763: protein of unknown function DUF74 |
Gene: TRQ2_0163: protein of unknown function DUF74 |
Gene: CTN_1816: protein of unknown function DUF74 |
Gene: Tpet_0165: protein of unknown function DUF74 |
Gene: Tnap_0561: protein of unknown function DUF74 |
|
|
Gene: Tmel_1129: protein of unknown function DUF74 |
Gene: Fnod_0426: protein of unknown function DUF74 |
|
|
protein of unknown function DUF74 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |