Regulon of TM0766 in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_1133
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	TM0766 - Thermotogales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 7.5 Sequence: CTGTAATAGTATAATATTACAG Locus tag: Tmel_1133 Name: TM0766 Funciton: hypothetical regulator TM0766, GntR family Locus tag: Tmel_1132 Name: TM0765 Funciton: hypothetical ABC transporter, ATP-binding protein Locus tag: Tmel_1131 Name: TM0764 Funciton: Hypothetical ABC transporter, permease protein Locus tag: Tmel_1130 Name: null Funciton: hypothetical protein Locus tag: Tmel_1129 Name: TM0763 Funciton: protein of unknown function DUF74
	Tmel_1133	TM0766	hypothetical regulator TM0766, GntR family
	Tmel_1132	TM0765	hypothetical ABC transporter, ATP-binding protein
	Tmel_1131	TM0764	Hypothetical ABC transporter, permease protein
	Tmel_1130		hypothetical protein
	Tmel_1129	TM0763	protein of unknown function DUF74

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD