Regulon of TM0766 in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0564
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	TM0766 - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 7.4 Sequence: GTGTAATAGTATAATATTACAG Locus tag: Tnap_0564 Name: TM0766 Funciton: hypothetical regulator TM0766, GntR family Locus tag: Tnap_0563 Name: TM0765 Funciton: hypothetical ABC transporter, ATP-binding protein Locus tag: Tnap_0562 Name: TM0764 Funciton: Hypothetical ABC transporter, permease protein Locus tag: Tnap_0561 Name: TM0763 Funciton: protein of unknown function DUF74
	Tnap_0564	TM0766	hypothetical regulator TM0766, GntR family
	Tnap_0563	TM0765	hypothetical ABC transporter, ATP-binding protein
	Tnap_0562	TM0764	Hypothetical ABC transporter, permease protein
	Tnap_0561	TM0763	protein of unknown function DUF74

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD