Regulon of TM0766 in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1559
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	TM0766 - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.7 Sequence: CTGTAATGTTGTAGTATTACAG Locus tag: Tlet_1559 Name: TM0766 Funciton: hypothetical regulator TM0766, GntR family Locus tag: Tlet_1560 Name: TM0765 Funciton: hypothetical ABC transporter, ATP-binding protein Locus tag: Tlet_1561 Name: TM0764 Funciton: Hypothetical ABC transporter, permease protein
	Tlet_1559	TM0766	hypothetical regulator TM0766, GntR family
	Tlet_1560	TM0765	hypothetical ABC transporter, ATP-binding protein
	Tlet_1561	TM0764	Hypothetical ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD