Regulon of TM0766 in Thermosipho africanus TCF52B

Properties
Regulator type:	Transcription factor
TF locus tag:	THA_1439
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	TM0766 - Thermotogales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.6 Sequence: CTGTAATATTATAATATTACAG Locus tag: THA_1439 Name: TM0766 Funciton: hypothetical regulator TM0766, GntR family
	THA_1439	TM0766	hypothetical regulator TM0766, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD