Orthologous regulated operons containing THA_1435 gene

Properties
Regulog:	TM0766 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Thermotogae

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermosipho melanesiensis BI429
Position: -54 Score: 7.52062 Sequence: CTGTAATAGTATAATATTACAG Locus tag: Tmel_1133 Name: TM0766 Funciton: hypothetical regulator TM0766, GntR family Locus tag: Tmel_1132 Name: TM0765 Funciton: hypothetical ABC transporter, ATP-binding protein Locus tag: Tmel_1131 Name: TM0764 Funciton: Hypothetical ABC transporter, permease protein Locus tag: Tmel_1130 Name: null Funciton: hypothetical protein Locus tag: Tmel_1129 Name: TM0763 Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-Tmel_1130-TM0763	-54	7.5	CTGTAATAGTATAATATTACAG	Tmel_1133

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --