Regulog YhcF - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 1 |
| Bacillus amyloliquefaciens FZB42 | 5 | 1 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | ||
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | 5 | 1 |
| Bacillus halodurans C-125 | 3 | 1 |
| Bacillus clausii KSM-K16 | 2 | 1 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 4 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yhcE |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -49 score = 6.38113 sequence = GTGTACTATGTTACTCATACAC Gene: BSU09050: Putative integral inner membrane protein |
*
Bacillus amyloliquefaciens FZB42 Site: position = -46 score = 6.38113 sequence = GTGTACTATGTTACTCATACAC Gene: RBAM_009320: Putative integral inner membrane protein |
|
|
|
|
|
|
|
|
|
Putative integral inner membrane protein |
| yhcF |
Gene: BSU09060: Transcriptional regulator, GntR family |
Gene: RBAM_009330: Transcriptional regulator, GntR family |
|
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -43 score = 6.87995 sequence = GTGTATTATTTAACTAGTACAC Gene: BC1356: Transcriptional regulator, GntR family |
Gene: BH0383: Transcriptional regulator, GntR family |
Gene: ABC1460: Transcriptional regulator, GntR family |
|
Gene: Pjdr2_3930: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| yhcG |
Gene: BSU09070: ABC-type multidrug transport system, ATPase component |
Gene: RBAM_009340: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: BC1357: ABC-type multidrug transport system, ATPase component |
Gene: BH0382: ABC-type multidrug transport system, ATPase component |
|
|
Gene: Pjdr2_3929: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| yhcH |
Gene: BSU09080: ABC transporter, ATP-binding protein |
Gene: RBAM_009350: ABC transporter, ATP-binding protein |
|
Gene: BLi00969: ABC transporter, ATP-binding protein |
|
|
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -44 score = 5.52196 sequence = GTGTACTATTCAACTATAACAC Gene: Pjdr2_3932: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| yhcI |
Gene: BSU09090: ABC-type multidrug transport system, permease component |
Gene: RBAM_009360: ABC-type multidrug transport system, permease component |
|
Gene: BLi00970: ABC-type multidrug transport system, permease component |
|
|
|
|
|
|
Gene: Pjdr2_3931: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
| BC1358 |
|
|
|
|
|
|
Gene: BC1358: ABC transporter permease protein |
|
|
|
|
ABC transporter permease protein |
| bcrA |
|
|
Gene: BPUM_0422: Bacitracin transport ATP-binding protein |
Gene: BLi04117: Bacitracin transport ATP-binding protein |
|
|
Gene: BC1359: Bacitracin transport ATP-binding protein |
|
*
Bacillus clausii KSM-K16 Site: position = -49 score = 6.49133 sequence = GTGTACTATTTAAATAGAACAC Gene: ABC1458: Bacitracin transport ATP-binding protein |
Gene: OB1714: Bacitracin transport ATP-binding protein |
Gene: Pjdr2_3970: Bacitracin transport ATP-binding protein |
Bacitracin transport ATP-binding protein |
| bcrB |
|
|
Gene: BPUM_0423: Bacitracin transport permease protein |
|
|
|
Gene: BC1360: Bacitracin transport permease protein |
|
Gene: ABC1459: Bacitracin transport permease protein |
|
|
Bacitracin transport permease protein |
| BH0384 |
|
|
|
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -51 score = 5.96421 sequence = GTGTACTATTTCATTAGCACAA Gene: BH0384: Hypothetical protein |
|
|
|
Hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |