Regulon of YhcF in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU09060
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.4 Sequence: GTGTACTATGTTACTCATACAC Locus tag: BSU09050 Name: yhcE Funciton: Putative integral inner membrane protein Locus tag: BSU09060 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BSU09070 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BSU09080 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: BSU09090 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	BSU09050	yhcE	Putative integral inner membrane protein
	BSU09060	yhcF	Transcriptional regulator, GntR family
	BSU09070	yhcG	ABC-type multidrug transport system, ATPase component
	BSU09080	yhcH	ABC transporter, ATP-binding protein
	BSU09090	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD