Regulon of YhcF in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH0383
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6 Sequence: GTGTACTATTTCATTAGCACAA Locus tag: BH0384 Name: BH0384 Funciton: Hypothetical protein Locus tag: BH0383 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BH0382 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
	BH0384	BH0384	Hypothetical protein
	BH0383	yhcF	Transcriptional regulator, GntR family
	BH0382	yhcG	ABC-type multidrug transport system, ATPase component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD