Regulon of YhcF in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_009330
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.4 Sequence: GTGTACTATGTTACTCATACAC Locus tag: RBAM_009320 Name: yhcE Funciton: Putative integral inner membrane protein Locus tag: RBAM_009330 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: RBAM_009340 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: RBAM_009350 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: RBAM_009360 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	RBAM_009320	yhcE	Putative integral inner membrane protein
	RBAM_009330	yhcF	Transcriptional regulator, GntR family
	RBAM_009340	yhcG	ABC-type multidrug transport system, ATPase component
	RBAM_009350	yhcH	ABC transporter, ATP-binding protein
	RBAM_009360	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD