Regulon of YhcF in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_3930
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.5 Sequence: GTGTACTATTCAACTATAACAC Locus tag: Pjdr2_3932 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Pjdr2_3931 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Pjdr2_3930 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Pjdr2_3929 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
	Pjdr2_3932	yhcH	ABC transporter, ATP-binding protein
	Pjdr2_3931	yhcI	ABC-type multidrug transport system, permease component
	Pjdr2_3930	yhcF	Transcriptional regulator, GntR family
	Pjdr2_3929	yhcG	ABC-type multidrug transport system, ATPase component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD