Regulon of YhcF in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC1356
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.9 Sequence: GTGTATTATTTAACTAGTACAC Locus tag: BC1356 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BC1357 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BC1358 Name: null Funciton: ABC transporter permease protein Locus tag: BC1359 Name: bcrA Funciton: Bacitracin transport ATP-binding protein Locus tag: BC1360 Name: bcrB Funciton: Bacitracin transport permease protein
	BC1356	yhcF	Transcriptional regulator, GntR family
	BC1357	yhcG	ABC-type multidrug transport system, ATPase component
	BC1358		ABC transporter permease protein
	BC1359	bcrA	Bacitracin transport ATP-binding protein
	BC1360	bcrB	Bacitracin transport permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD