Regulon of YhcF in Bacillus cereus ATCC 14579
| Regulator type: | Transcription factor |
| TF locus tag: | BC1356 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Regulog: | YhcF - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 5 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -43
Score: 6.9 Sequence: GTGTATTATTTAACTAGTACAC
Locus tag: BC1356
Name: yhcF Funciton: Transcriptional regulator, GntR family
Locus tag: BC1357
Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BC1358
Name: null Funciton: ABC transporter permease protein
Locus tag: BC1359
Name: bcrA Funciton: Bacitracin transport ATP-binding protein
Locus tag: BC1360
Name: bcrB Funciton: Bacitracin transport permease protein |
|||
|
yhcF
|
Transcriptional regulator, GntR family
|
||
|
yhcG
|
ABC-type multidrug transport system, ATPase component
|
||
|
ABC transporter permease protein
|
|||
|
bcrA
|
Bacitracin transport ATP-binding protein
|
||
|
bcrB
|
Bacitracin transport permease protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |