Regulon of YhcF in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC1460
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.5 Sequence: GTGTACTATTTAAATAGAACAC Locus tag: ABC1458 Name: bcrA Funciton: Bacitracin transport ATP-binding protein Locus tag: ABC1459 Name: bcrB Funciton: Bacitracin transport permease protein
	ABC1458	bcrA	Bacitracin transport ATP-binding protein
	ABC1459	bcrB	Bacitracin transport permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD