Regulog RutR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Enterobacteriales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 10 | 3 |
| Salmonella typhimurium LT2 | 2 | 1 |
| Citrobacter koseri ATCC BAA-895 | 2 | 1 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 10 | 3 |
| Enterobacter sp. 638 | 9 | 2 |
| Erwinia amylovora ATCC 49946 | 2 | 1 |
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | 7 | 2 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| rutA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -126 score = 6.18212 sequence = TTTTGACCGTTTAGTCCACT Gene: b1012: Pyrimidine oxygenase |
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -181 score = 5.96368 sequence = TTTTGACCATCCAGTCCACT Gene: KPN_01038: Pyrimidine oxygenase |
*
Enterobacter sp. 638 Site: position = -185 score = 6.09165 sequence = TTTTGACCATTCAGTCCACT Gene: Ent638_1525: Pyrimidine oxygenase |
|
|
*
Serratia proteamaculans 568 Site: position = -187 score = 5.81869 sequence = TTTTGACCAAATGGTCTGTT Gene: Spro_1823: Pyrimidine oxygenase |
|
|
|
|
Pyrimidine oxygenase |
| rutB |
Gene: b1011: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
Gene: KPN_01037: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
Gene: Ent638_1524: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
Gene: Spro_1822: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
|
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
Gene: b1010: Aminoacrylate peracid reductase |
|
|
Gene: KPN_01036: Aminoacrylate peracid reductase |
Gene: Ent638_1523: Aminoacrylate peracid reductase |
|
|
Gene: Spro_1821: Aminoacrylate peracid reductase |
|
|
|
|
Aminoacrylate peracid reductase |
| rutD |
Gene: b1009: Aminoacrylate hydrolase |
|
|
Gene: KPN_01035: Aminoacrylate hydrolase |
Gene: Ent638_1522: Aminoacrylate hydrolase |
|
|
Gene: Spro_1820: Aminoacrylate hydrolase |
|
|
|
|
Aminoacrylate hydrolase |
| rutE |
Gene: b1008: 3-hydroxy propionic acid dehydrogenase |
|
|
Gene: KPN_01034: 3-hydroxy propionic acid dehydrogenase |
Gene: Ent638_1521: 3-hydroxy propionic acid dehydrogenase |
|
|
|
|
|
|
|
3-hydroxy propionic acid dehydrogenase |
| rutF |
Gene: b1007: Flavin reductase |
|
|
Gene: KPN_01033: Flavin reductase |
Gene: Ent638_1520: Flavin reductase |
|
|
Gene: Spro_1819: Flavin reductase |
|
|
|
|
Flavin reductase |
| rutG |
Gene: b1006: Uracil permease |
|
|
Gene: KPN_01032: Uracil permease |
Gene: Ent638_1519: Uracil permease |
|
|
Gene: Spro_1818: Uracil permease |
|
|
|
|
Uracil permease |
| CRON 2. | |||||||||||||
| carA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -294 score = 6.52383 sequence = TTTTGACCATTTGGTCCACT Gene: b0032: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
*
Salmonella typhimurium LT2 Site: position = -294 score = 6.50468 sequence = ATTTGACCATTTGGTCCACT Gene: STM0066: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -268 score = 6.3552 sequence = TTTTGACCAAATGGTCCACT Gene: CKO_03351: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -267 score = 6.39586 sequence = TTTTGACCATCTGGTCCACT Gene: KPN_00040: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
*
Enterobacter sp. 638 Site: position = -294 score = 5.84697 sequence = TTTTGACCATTTGGTCTGGT Gene: Ent638_0591: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
*
Erwinia amylovora ATCC 49946 Site: position = -297 score = 6.21231 sequence = TTCTGACCATTTGGTCCACT Gene: EAM_0660: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: y3693: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: Spro_0713: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: ECA3871: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: ETAE_0593: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: PMI0020: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Gene: plu0603: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) |
| carB |
Gene: b0033: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: STM0067: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: CKO_03350: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: KPN_00041: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: Ent638_0592: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: EAM_0661: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: y3692: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: Spro_0714: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: ECA3870: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: ETAE_0594: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: PMI0021: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Gene: plu0604: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) |
| CRON 3. | |||||||||||||
| rutR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -124 score = 4.34619 sequence = AGTGGACTAAACGGTCAAAA Gene: b1013: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: STM1122: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: CKO_02045: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -123 score = 4.16644 sequence = AGTGGACTGGATGGTCAAAA Gene: KPN_01039: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: Ent638_1539: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: EAM_1396: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
*
Serratia proteamaculans 568 Site: position = -118 score = 4.95994 sequence = AACAGACCATTTGGTCAAAA Gene: Spro_1824: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
|
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |