Regulon of RutR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_01039
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Enterobacteriales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 4.2 Sequence: AGTGGACTGGATGGTCAAAA Locus tag: KPN_01039 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	KPN_01039	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -181 Score: 6 Sequence: TTTTGACCATCCAGTCCACT Locus tag: KPN_01038 Name: rutA Funciton: Pyrimidine oxygenase Locus tag: KPN_01037 Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Locus tag: KPN_01036 Name: rutC Funciton: Aminoacrylate peracid reductase Locus tag: KPN_01035 Name: rutD Funciton: Aminoacrylate hydrolase Locus tag: KPN_01034 Name: rutE Funciton: 3-hydroxy propionic acid dehydrogenase Locus tag: KPN_01033 Name: rutF Funciton: Flavin reductase Locus tag: KPN_01032 Name: rutG Funciton: Uracil permease
	KPN_01038	rutA	Pyrimidine oxygenase
	KPN_01037	rutB	Peroxyureidoacrylate / ureidoacrylate amido hydrolase
	KPN_01036	rutC	Aminoacrylate peracid reductase
	KPN_01035	rutD	Aminoacrylate hydrolase
	KPN_01034	rutE	3-hydroxy propionic acid dehydrogenase
	KPN_01033	rutF	Flavin reductase
	KPN_01032	rutG	Uracil permease
Position: -267 Score: 6.4 Sequence: TTTTGACCATCTGGTCCACT Locus tag: KPN_00040 Name: carA Funciton: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) Locus tag: KPN_00041 Name: carB Funciton: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
	KPN_00040	carA	Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
	KPN_00041	carB	Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD