Regulon of RutR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1013
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Enterobacteriales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 4.3 Sequence: AGTGGACTAAACGGTCAAAA Locus tag: b1013 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	b1013	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -126 Score: 6.2 Sequence: TTTTGACCGTTTAGTCCACT Locus tag: b1012 Name: rutA Funciton: Pyrimidine oxygenase Locus tag: b1011 Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Locus tag: b1010 Name: rutC Funciton: Aminoacrylate peracid reductase Locus tag: b1009 Name: rutD Funciton: Aminoacrylate hydrolase Locus tag: b1008 Name: rutE Funciton: 3-hydroxy propionic acid dehydrogenase Locus tag: b1007 Name: rutF Funciton: Flavin reductase Locus tag: b1006 Name: rutG Funciton: Uracil permease
	b1012	rutA	Pyrimidine oxygenase
	b1011	rutB	Peroxyureidoacrylate / ureidoacrylate amido hydrolase
	b1010	rutC	Aminoacrylate peracid reductase
	b1009	rutD	Aminoacrylate hydrolase
	b1008	rutE	3-hydroxy propionic acid dehydrogenase
	b1007	rutF	Flavin reductase
	b1006	rutG	Uracil permease
Position: -294 Score: 6.5 Sequence: TTTTGACCATTTGGTCCACT Locus tag: b0032 Name: carA Funciton: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) Locus tag: b0033 Name: carB Funciton: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
	b0032	carA	Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
	b0033	carB	Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD