Regulon of RutR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_1539
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Enterobacteriales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -185 Score: 6.1 Sequence: TTTTGACCATTCAGTCCACT Locus tag: Ent638_1525 Name: rutA Funciton: Pyrimidine oxygenase Locus tag: Ent638_1524 Name: rutB Funciton: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Locus tag: Ent638_1523 Name: rutC Funciton: Aminoacrylate peracid reductase Locus tag: Ent638_1522 Name: rutD Funciton: Aminoacrylate hydrolase Locus tag: Ent638_1521 Name: rutE Funciton: 3-hydroxy propionic acid dehydrogenase Locus tag: Ent638_1520 Name: rutF Funciton: Flavin reductase Locus tag: Ent638_1519 Name: rutG Funciton: Uracil permease
	Ent638_1525	rutA	Pyrimidine oxygenase
	Ent638_1524	rutB	Peroxyureidoacrylate / ureidoacrylate amido hydrolase
	Ent638_1523	rutC	Aminoacrylate peracid reductase
	Ent638_1522	rutD	Aminoacrylate hydrolase
	Ent638_1521	rutE	3-hydroxy propionic acid dehydrogenase
	Ent638_1520	rutF	Flavin reductase
	Ent638_1519	rutG	Uracil permease
Position: -294 Score: 5.8 Sequence: TTTTGACCATTTGGTCTGGT Locus tag: Ent638_0591 Name: carA Funciton: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) Locus tag: Ent638_0592 Name: carB Funciton: Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)
	Ent638_0591	carA	Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
	Ent638_0592	carB	Carbamoyl-phosphate synthase large chain (EC 6.3.5.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD