Regulog DVU0030 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/MocR |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/MocR
- By pathway - Amino acid transport
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | 3 | 2 |
| Desulfovibrio vulgaris str. Miyazaki F | 3 | 2 |
| Desulfovibrio desulfuricans G20 | 3 | 2 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 4 | 2 |
| Desulfovibrio magneticus RS-1 | 1 | 1 |
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | 4 | 2 |
| Desulfohalobium retbaense DSM 5692 | 3 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DVU0031 |
*
Desulfovibrio vulgaris Hildenborough Site: position = -431 score = 5.15382 sequence = TAAAAACTGTATCTGTCATCA Gene: DVU0031: Branched-chain amino acid transport protein azlC |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -124 score = 4.4142 sequence = GTTTGACTGTATCTGTTCAGG Gene: DvMF_2174: Branched-chain amino acid transport protein azlC |
*
Desulfovibrio desulfuricans G20 Site: position = -109 score = 4.61573 sequence = TGAAAATTGTATCTGTGTTTG Site: position = -127 score = 5.56084 sequence = TAAAAACTGTATCTGTTCTGA Gene: Dde_0158: Branched-chain amino acid transport protein azlC |
Gene: Ddes_0523: Branched-chain amino acid transport protein azlC |
Gene: DESPIG_02860: Branched-chain amino acid transport protein azlC |
*
Desulfovibrio salexigens DSM 2638 Site: position = -93 score = 4.85103 sequence = TAAAATCTGTATCTGTACTGA Site: position = -118 score = 4.89434 sequence = CTAAAACTGTTACGGTTCATA Gene: Desal_3216: Branched-chain amino acid transport protein azlC |
Gene: DMR_42190: Branched-chain amino acid transport protein azlC |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -64 score = 4.35463 sequence = CGCAAACTGTATCTGTACCGC Gene: Dbac_3053: Branched-chain amino acid transport protein azlC |
*
Desulfohalobium retbaense DSM 5692 Site: position = -372 score = 4.47259 sequence = TCGAAATTGTATCTGTCTCAG Gene: Dret_1470: Branched-chain amino acid transport protein azlC |
Branched-chain amino acid transport protein azlC |
| DVU0032 |
Gene: DVU0032: Branched-chain amino acid transport protein azlD |
Gene: DvMF_2173: Branched-chain amino acid transport protein azlD |
Gene: Dde_0159: Branched-chain amino acid transport protein azlD |
Gene: Ddes_0522: Branched-chain amino acid transport protein azlD |
Gene: DESPIG_02861: Branched-chain amino acid transport protein azlD |
Gene: Desal_3217: Branched-chain amino acid transport protein azlD |
Gene: DMR_42200: Branched-chain amino acid transport protein azlD |
|
Gene: Dbac_3054: Branched-chain amino acid transport protein azlD |
Gene: Dret_1469: Branched-chain amino acid transport protein azlD |
Branched-chain amino acid transport protein azlD |
| Dbac_3055 |
|
|
|
|
|
|
|
|
Gene: Dbac_3055: putative aminotransferase |
|
putative aminotransferase |
| Desal_3218 |
|
|
|
|
|
Gene: Desal_3218: metal dependent phosphohydrolase |
|
|
|
|
metal dependent phosphohydrolase |
| CRON 2. | |||||||||||
| DVU0030 |
*
Desulfovibrio vulgaris Hildenborough Site: position = -40 score = 5.15382 sequence = TGATGACAGATACAGTTTTTA Gene: DVU0030: transcriptional regulator, GntR family |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -196 score = 4.4142 sequence = CCTGAACAGATACAGTCAAAC Gene: DvMF_2175: transcriptional regulator, GntR family |
*
Desulfovibrio desulfuricans G20 Site: position = -44 score = 5.56084 sequence = TCAGAACAGATACAGTTTTTA Site: position = -62 score = 4.61573 sequence = CAAACACAGATACAATTTTCA Gene: Dde_0157: transcriptional regulator, GntR family |
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -39 score = 4.89434 sequence = TATGAACCGTAACAGTTTTAG Site: position = -64 score = 4.85103 sequence = TCAGTACAGATACAGATTTTA Gene: Desal_3215: transcriptional regulator, GntR family |
*
Desulfovibrio magneticus RS-1 Site: position = -71 score = 4.65342 sequence = CCATCACAGACACAGTTTTCA Gene: DMR_35550: transcriptional regulator, GntR family |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -536 score = 4.35463 sequence = GCGGTACAGATACAGTTTGCG Gene: Dbac_3052: transcriptional regulator, GntR family |
*
Desulfohalobium retbaense DSM 5692 Site: position = -40 score = 4.47259 sequence = CTGAGACAGATACAATTTCGA Gene: Dret_1471: transcriptional regulator, GntR family |
transcriptional regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |