Regulon of DVU0030 in Desulfovibrio magneticus RS-1
| Regulator type: | Transcription factor |
| TF locus tag: | DMR_35550 |
| Regulator family: | GntR/MocR |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Regulog: | DVU0030 - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/MocR
- By pathway - Amino acid transport
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -71
Score: 4.7 Sequence: CCATCACAGACACAGTTTTCA
Locus tag: DMR_35550
Name: null Funciton: transcriptional regulator, GntR family |
|||
|
transcriptional regulator, GntR family
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |