Regulon of DVU0030 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_3052
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Amino acid transport
Effector:
Regulog:	DVU0030 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/MocR
By pathway - Amino acid transport

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 4.4 Sequence: CGCAAACTGTATCTGTACCGC Locus tag: Dbac_3053 Name: null Funciton: Branched-chain amino acid transport protein azlC Locus tag: Dbac_3054 Name: null Funciton: Branched-chain amino acid transport protein azlD Locus tag: Dbac_3055 Name: null Funciton: putative aminotransferase
	Dbac_3053		Branched-chain amino acid transport protein azlC
	Dbac_3054		Branched-chain amino acid transport protein azlD
	Dbac_3055		putative aminotransferase
Position: -536 Score: 4.4 Sequence: GCGGTACAGATACAGTTTGCG Locus tag: Dbac_3052 Name: null Funciton: transcriptional regulator, GntR family
	Dbac_3052		transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD