Regulon of DVU0030 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2175
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Amino acid transport
Effector:
Regulog:	DVU0030 - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/MocR
By pathway - Amino acid transport

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 4.4 Sequence: GTTTGACTGTATCTGTTCAGG Locus tag: DvMF_2174 Name: null Funciton: Branched-chain amino acid transport protein azlC Locus tag: DvMF_2173 Name: null Funciton: Branched-chain amino acid transport protein azlD
	DvMF_2174		Branched-chain amino acid transport protein azlC
	DvMF_2173		Branched-chain amino acid transport protein azlD
Position: -196 Score: 4.4 Sequence: CCTGAACAGATACAGTCAAAC Locus tag: DvMF_2175 Name: null Funciton: transcriptional regulator, GntR family
	DvMF_2175		transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD