Regulon of DVU0030 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_3215
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Amino acid transport
Effector:
Regulog:	DVU0030 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/MocR
By pathway - Amino acid transport

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 4.9 Sequence: CTAAAACTGTTACGGTTCATA Position: -93 Score: 4.9 Sequence: TAAAATCTGTATCTGTACTGA Locus tag: Desal_3216 Name: null Funciton: Branched-chain amino acid transport protein azlC Locus tag: Desal_3217 Name: null Funciton: Branched-chain amino acid transport protein azlD Locus tag: Desal_3218 Name: null Funciton: metal dependent phosphohydrolase
	Desal_3216		Branched-chain amino acid transport protein azlC
	Desal_3217		Branched-chain amino acid transport protein azlD
	Desal_3218		metal dependent phosphohydrolase
Position: -64 Score: 4.9 Sequence: TCAGTACAGATACAGATTTTA Position: -39 Score: 4.9 Sequence: TATGAACCGTAACAGTTTTAG Locus tag: Desal_3215 Name: null Funciton: transcriptional regulator, GntR family
	Desal_3215		transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD