Regulog GanR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactan utilization |
| Effector: | Beta-galactosides |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactan utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 6 | 2 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | 6 | 2 |
| Bacillus licheniformis DSM 13 | 6 | 2 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | 5 | 1 |
| Bacillus clausii KSM-K16 | 5 | 1 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ganR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -54 score = 6.56991 sequence = GAAAGTAAAATATTTTACTAAA Gene: BSU34170: Transcriptional regulator of galactan utilization operon, LacI family |
|
*
Bacillus pumilus SAFR-032 Site: position = -74 score = 5.55258 sequence = TTTAATAAAAATATTTACTAAT Gene: BPUM_3612: Transcriptional regulator of galactan utilization operon, LacI family |
*
Bacillus licheniformis DSM 13 Site: position = -69 score = 7.00316 sequence = ATTAGTAAAATATTTTACTAAA Gene: BLi04281: Transcriptional regulator of galactan utilization operon, LacI family |
|
|
|
Gene: BH2018: Transcriptional regulator of galactan utilization operon, LacI family |
Gene: ABC3521: Transcriptional regulator of galactan utilization operon, LacI family |
|
|
Transcriptional regulator of galactan utilization operon, LacI family |
| CRON 2. | ||||||||||||
| ganO |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -109 score = 5.91324 sequence = TTAGGTAAAAAAATTTACTCTA Gene: BSU34160: Arabinogalactan oligomer ABC transporter, binding protein |
|
*
Bacillus pumilus SAFR-032 Site: position = -126 score = 6.79557 sequence = TTGAGTAAAAAATTTTACTTAA Gene: BPUM_3613: Arabinogalactan oligomer ABC transporter, binding protein |
*
Bacillus licheniformis DSM 13 Site: position = -110 score = 5.78815 sequence = TTTCGTAAAACATTTTACCTGT Gene: BLi04280: Arabinogalactan oligomer ABC transporter, binding protein |
Gene: Aflv_2191: Arabinogalactan oligomer ABC transporter, binding protein |
|
|
*
Bacillus halodurans C-125 Site: position = -127 score = 5.90124 sequence = TTTCCGAAAATATTTTACTCAT Gene: BH2019: Arabinogalactan oligomer ABC transporter, binding protein |
*
Bacillus clausii KSM-K16 Site: position = -108 score = 7.16308 sequence = TTAAGTAAAATATTTTACTAAA Gene: ABC3520: Arabinogalactan oligomer ABC transporter, binding protein |
|
|
Arabinogalactan oligomer ABC transporter, binding protein |
| ganP |
Gene: BSU34150: Arabinogalactan oligomer ABC transporter, membrane protein |
|
Gene: BPUM_3614: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: BLi04279: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: Aflv_2190: Arabinogalactan oligomer ABC transporter, membrane protein |
|
Gene: BC4012: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: BH2020: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: ABC3519: Arabinogalactan oligomer ABC transporter, membrane protein |
|
|
Arabinogalactan oligomer ABC transporter, membrane protein |
| ganQ |
Gene: BSU34140: Arabinogalactan oligomer ABC transporter, membrane protein |
|
Gene: BPUM_3615: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: BLi04278: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: Aflv_2189: Arabinogalactan oligomer ABC transporter, membrane protein |
|
Gene: BC4011: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: BH2021: Arabinogalactan oligomer ABC transporter, membrane protein |
Gene: ABC3518: Arabinogalactan oligomer ABC transporter, membrane protein |
|
|
Arabinogalactan oligomer ABC transporter, membrane protein |
| ganB |
Gene: BSU34120: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
|
Gene: BPUM_3616: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
Gene: BLi04276: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
|
|
|
Gene: BH2023: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
Gene: ABC3517: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
|
|
Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) |
| ganA |
Gene: BSU34130: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
|
Gene: BPUM_3617: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
2
Bacillus licheniformis DSM 13 Gene: BLi00447: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Gene: BLi04277: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
|
|
|
Gene: BH2022: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
Gene: ABC3516: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
|
Gene: Pjdr2_1514: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |