Regulog GanR - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Statistics of regulated genes
Genome	Genes	Operons
Bacillus subtilis subsp. subtilis str. 168	6	2
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032	6	2
Bacillus licheniformis DSM 13	6	2
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125	5	1
Bacillus clausii KSM-K16	5	1
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
ganR	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -54 score = 6.56991 sequence = GAAAGTAAAATATTTTACTAAA Gene: BSU34170: Transcriptional regulator of galactan utilization operon, LacI family	Bacillus amyloliquefaciens FZB42	* Bacillus pumilus SAFR-032 Site: position = -74 score = 5.55258 sequence = TTTAATAAAAATATTTACTAAT Gene: BPUM_3612: Transcriptional regulator of galactan utilization operon, LacI family	* Bacillus licheniformis DSM 13 Site: position = -69 score = 7.00316 sequence = ATTAGTAAAATATTTTACTAAA Gene: BLi04281: Transcriptional regulator of galactan utilization operon, LacI family	Anoxybacillus flavithermus WK1	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	Bacillus halodurans C-125 Gene: BH2018: Transcriptional regulator of galactan utilization operon, LacI family	Bacillus clausii KSM-K16 Gene: ABC3521: Transcriptional regulator of galactan utilization operon, LacI family	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Transcriptional regulator of galactan utilization operon, LacI family

CRON 2.
ganO	* Bacillus subtilis subsp. subtilis str. 168 Site: position = -109 score = 5.91324 sequence = TTAGGTAAAAAAATTTACTCTA Gene: BSU34160: Arabinogalactan oligomer ABC transporter, binding protein	Bacillus amyloliquefaciens FZB42	* Bacillus pumilus SAFR-032 Site: position = -126 score = 6.79557 sequence = TTGAGTAAAAAATTTTACTTAA Gene: BPUM_3613: Arabinogalactan oligomer ABC transporter, binding protein	* Bacillus licheniformis DSM 13 Site: position = -110 score = 5.78815 sequence = TTTCGTAAAACATTTTACCTGT Gene: BLi04280: Arabinogalactan oligomer ABC transporter, binding protein	Anoxybacillus flavithermus WK1 Gene: Aflv_2191: Arabinogalactan oligomer ABC transporter, binding protein	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	* Bacillus halodurans C-125 Site: position = -127 score = 5.90124 sequence = TTTCCGAAAATATTTTACTCAT Gene: BH2019: Arabinogalactan oligomer ABC transporter, binding protein	* Bacillus clausii KSM-K16 Site: position = -108 score = 7.16308 sequence = TTAAGTAAAATATTTTACTAAA Gene: ABC3520: Arabinogalactan oligomer ABC transporter, binding protein	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Arabinogalactan oligomer ABC transporter, binding protein
ganP	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU34150: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus amyloliquefaciens FZB42	Bacillus pumilus SAFR-032 Gene: BPUM_3614: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus licheniformis DSM 13 Gene: BLi04279: Arabinogalactan oligomer ABC transporter, membrane protein	Anoxybacillus flavithermus WK1 Gene: Aflv_2190: Arabinogalactan oligomer ABC transporter, membrane protein	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579 Gene: BC4012: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus halodurans C-125 Gene: BH2020: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus clausii KSM-K16 Gene: ABC3519: Arabinogalactan oligomer ABC transporter, membrane protein	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Arabinogalactan oligomer ABC transporter, membrane protein
ganQ	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU34140: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus amyloliquefaciens FZB42	Bacillus pumilus SAFR-032 Gene: BPUM_3615: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus licheniformis DSM 13 Gene: BLi04278: Arabinogalactan oligomer ABC transporter, membrane protein	Anoxybacillus flavithermus WK1 Gene: Aflv_2189: Arabinogalactan oligomer ABC transporter, membrane protein	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579 Gene: BC4011: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus halodurans C-125 Gene: BH2021: Arabinogalactan oligomer ABC transporter, membrane protein	Bacillus clausii KSM-K16 Gene: ABC3518: Arabinogalactan oligomer ABC transporter, membrane protein	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Arabinogalactan oligomer ABC transporter, membrane protein
ganB	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU34120: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)	Bacillus amyloliquefaciens FZB42	Bacillus pumilus SAFR-032 Gene: BPUM_3616: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)	Bacillus licheniformis DSM 13 Gene: BLi04276: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)	Anoxybacillus flavithermus WK1	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	Bacillus halodurans C-125 Gene: BH2023: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)	Bacillus clausii KSM-K16 Gene: ABC3517: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
ganA	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU34130: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	Bacillus amyloliquefaciens FZB42	Bacillus pumilus SAFR-032 Gene: BPUM_3617: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	2 Bacillus licheniformis DSM 13 Gene: BLi00447: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Gene: BLi04277: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	Anoxybacillus flavithermus WK1	Geobacillus kaustophilus HTA426	Bacillus cereus ATCC 14579	Bacillus halodurans C-125 Gene: BH2022: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	Bacillus clausii KSM-K16 Gene: ABC3516: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2 Gene: Pjdr2_1514: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog GanR - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --