Regulon of GanR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH2018
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Regulog:	GanR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -127 Score: 5.9 Sequence: TTTCCGAAAATATTTTACTCAT Locus tag: BH2019 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BH2020 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BH2021 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BH2022 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BH2023 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
	BH2019	ganO	Arabinogalactan oligomer ABC transporter, binding protein
	BH2020	ganP	Arabinogalactan oligomer ABC transporter, membrane protein
	BH2021	ganQ	Arabinogalactan oligomer ABC transporter, membrane protein
	BH2022	ganA	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
	BH2023	ganB	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD