Regulon of GanR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC3521
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Regulog:	GanR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 7.2 Sequence: TTAAGTAAAATATTTTACTAAA Locus tag: ABC3520 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: ABC3519 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: ABC3518 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: ABC3517 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) Locus tag: ABC3516 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
	ABC3520	ganO	Arabinogalactan oligomer ABC transporter, binding protein
	ABC3519	ganP	Arabinogalactan oligomer ABC transporter, membrane protein
	ABC3518	ganQ	Arabinogalactan oligomer ABC transporter, membrane protein
	ABC3517	ganB	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
	ABC3516	ganA	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD