Regulon of GanR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_3612
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Regulog:	GanR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.6 Sequence: TTTAATAAAAATATTTACTAAT Locus tag: BPUM_3612 Name: ganR Funciton: Transcriptional regulator of galactan utilization operon, LacI family
	BPUM_3612	ganR	Transcriptional regulator of galactan utilization operon, LacI family
Position: -126 Score: 6.8 Sequence: TTGAGTAAAAAATTTTACTTAA Locus tag: BPUM_3613 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BPUM_3614 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BPUM_3615 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BPUM_3616 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) Locus tag: BPUM_3617 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
	BPUM_3613	ganO	Arabinogalactan oligomer ABC transporter, binding protein
	BPUM_3614	ganP	Arabinogalactan oligomer ABC transporter, membrane protein
	BPUM_3615	ganQ	Arabinogalactan oligomer ABC transporter, membrane protein
	BPUM_3616	ganB	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
	BPUM_3617	ganA	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD