Regulon of GanR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU34170
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Regulog:	GanR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.6 Sequence: GAAAGTAAAATATTTTACTAAA Locus tag: BSU34170 Name: ganR Funciton: Transcriptional regulator of galactan utilization operon, LacI family
	BSU34170	ganR	Transcriptional regulator of galactan utilization operon, LacI family
Position: -109 Score: 5.9 Sequence: TTAGGTAAAAAAATTTACTCTA Locus tag: BSU34160 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BSU34150 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BSU34140 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BSU34130 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BSU34120 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
	BSU34160	ganO	Arabinogalactan oligomer ABC transporter, binding protein
	BSU34150	ganP	Arabinogalactan oligomer ABC transporter, membrane protein
	BSU34140	ganQ	Arabinogalactan oligomer ABC transporter, membrane protein
	BSU34130	ganA	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
	BSU34120	ganB	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD