Regulon of GanR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi04281
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Regulog:	GanR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 7 Sequence: ATTAGTAAAATATTTTACTAAA Locus tag: BLi04281 Name: ganR Funciton: Transcriptional regulator of galactan utilization operon, LacI family
	BLi04281	ganR	Transcriptional regulator of galactan utilization operon, LacI family
Position: -110 Score: 5.8 Sequence: TTTCGTAAAACATTTTACCTGT Locus tag: BLi04280 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BLi04279 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BLi04278 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BLi04277 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BLi04276 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
	BLi04280	ganO	Arabinogalactan oligomer ABC transporter, binding protein
	BLi04279	ganP	Arabinogalactan oligomer ABC transporter, membrane protein
	BLi04278	ganQ	Arabinogalactan oligomer ABC transporter, membrane protein
	BLi04277	ganA	Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
	BLi04276	ganB	Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD