Regulog RhaR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization; Rhamnose oligosaccharides utilization |
| Effector: | Rhamnose |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - DeoR
- By effector - Rhamnose
- By pathway - Rhamnose utilization
- By pathway - Rhamnose oligosaccharides utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 14 | 3 |
| Thermotoga sp. RQ2 | ||
| Thermotoga neapolitana DSM 4359 | 12 | 3 |
| Thermotoga petrophila RKU-1 | 21 | 3 |
| Thermotoga naphthophila RKU-10 | 11 | 3 |
| Thermotoga lettingae TMO | ||
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| rtpE |
*
Thermotoga maritima MSB8 Site: position = -74 score = 6.06447 sequence = TGTTGATATTATATTGATAA Gene: TM1067: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component |
Gene: TRQ2_0510: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component |
*2
Thermotoga neapolitana DSM 4359 Site: position = -54 score = 5.56873 sequence = TATTGATACTATATTGATAG Gene: CTN_1502: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Gene: CTN_1503: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component |
*2
Thermotoga petrophila RKU-1 Gene: Tpet_1687: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Site: position = -78 score = 5.67162 sequence = AGTTGATATCATATTGATAA Gene: Tpet_1677: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component |
| Tpet_1678 |
|
|
|
Gene: Tpet_1678: FG-GAP repeat protein |
|
|
|
|
|
|
|
FG-GAP repeat protein |
| aguE2 |
|
|
|
Gene: Tpet_1679: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein |
| aguF2 |
|
|
|
Gene: Tpet_1680: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1 |
| aguG2 |
|
|
|
Gene: Tpet_1681: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2 |
| ramA |
|
|
|
*
Thermotoga petrophila RKU-1 Site: position = -47 score = 5.3023 sequence = TTATGATAAATTTATGATCG Gene: Tpet_1682: alpha-L-rhamnosidase |
|
|
|
|
|
|
|
alpha-L-rhamnosidase |
| rtpF |
Gene: TM1066: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 |
Gene: TRQ2_0509: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 |
|
Gene: Tpet_1683: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 |
|
|
|
|
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, permease component 1 |
| rtpG |
Gene: TM1065: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 |
Gene: TRQ2_0508: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 |
|
Gene: Tpet_1684: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 |
|
|
|
|
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, permease component 2 |
| rtpK |
Gene: TM1064: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 |
Gene: TRQ2_0507: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 |
|
Gene: Tpet_1685: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 |
|
|
|
|
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 |
| rtpL |
Gene: TM1063: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 |
Gene: TRQ2_0506: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 |
|
Gene: Tpet_1686: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 |
|
|
|
|
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 |
| bglJ |
|
|
Gene: CTN_1504: putative beta-glucosidase |
Gene: Tpet_1688: putative beta-glucosidase |
|
|
|
|
|
|
|
putative beta-glucosidase |
| gusB |
Gene: TM1062: putative beta-glucuronidase |
|
Gene: CTN_1505: putative beta-glucuronidase |
Gene: Tpet_1689: putative beta-glucuronidase |
Gene: Tnap_1703: putative beta-glucuronidase |
|
|
|
|
|
|
putative beta-glucuronidase |
| TM1061 |
Gene: TM1061: putative unsaturated glucuronyl hydrolase |
|
Gene: CTN_1506: putative unsaturated glucuronyl hydrolase |
Gene: Tpet_1690: putative unsaturated glucuronyl hydrolase |
|
|
|
|
|
|
|
putative unsaturated glucuronyl hydrolase |
| Tnap_1699 |
|
|
|
|
*
Thermotoga naphthophila RKU-10 Site: position = -42 score = 5.71145 sequence = ATTAGATAAATTTATGATAA Gene: Tnap_1699: predicted rhamnose ABC transporter, ATP-binding protein |
|
|
|
|
|
|
predicted rhamnose ABC transporter, ATP-binding protein |
| Tnap_1700 |
|
|
|
|
Gene: Tnap_1700: predicted rhamnose ABC transporter, permease protein |
|
|
|
|
|
|
predicted rhamnose ABC transporter, permease protein |
| Tnap_1701 |
|
|
|
|
Gene: Tnap_1701: predicted rhamnose ABC transporter, permease protein |
|
|
|
|
|
|
predicted rhamnose ABC transporter, permease protein |
| Tnap_1702 |
|
|
|
|
Gene: Tnap_1702: predicted rhamnose ABC transporter, solute-binding protein |
|
|
|
|
|
|
predicted rhamnose ABC transporter, solute-binding protein |
| CRON 2. | ||||||||||||
| rhaM2 |
*
Thermotoga maritima MSB8 Site: position = -56 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: TM1070: L-rhamnose mutarotase, alternative |
|
*
Thermotoga neapolitana DSM 4359 Site: position = -57 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: CTN_1499: L-rhamnose mutarotase, alternative |
*
Thermotoga petrophila RKU-1 Site: position = -56 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: Tpet_1674: L-rhamnose mutarotase, alternative |
*
Thermotoga naphthophila RKU-10 Site: position = -57 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: Tnap_1697: L-rhamnose mutarotase, alternative |
|
|
|
|
|
|
L-rhamnose mutarotase, alternative |
| rhaA |
Gene: TM1071: Alternative L-rhamnose isomerase (EC 5.3.1.14) |
|
Gene: CTN_1498: Alternative L-rhamnose isomerase (EC 5.3.1.14) |
Gene: Tpet_1673: Alternative L-rhamnose isomerase (EC 5.3.1.14) |
Gene: Tnap_1696: Alternative L-rhamnose isomerase (EC 5.3.1.14) |
|
|
|
|
|
|
Alternative L-rhamnose isomerase (EC 5.3.1.14) |
| rhaD |
Gene: TM1072: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
Gene: TRQ2_1745: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
Gene: CTN_1497: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
Gene: Tpet_1672: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
Gene: Tnap_1695: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
|
|
|
|
|
|
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) |
| rhaB |
Gene: TM1073: Rhamnulokinase (EC 2.7.1.5) |
Gene: TRQ2_1744: Rhamnulokinase (EC 2.7.1.5) |
Gene: CTN_1496: Rhamnulokinase (EC 2.7.1.5) |
Gene: Tpet_1671: Rhamnulokinase (EC 2.7.1.5) |
Gene: Tnap_1694: Rhamnulokinase (EC 2.7.1.5) |
|
|
|
|
|
|
Rhamnulokinase (EC 2.7.1.5) |
| rhaC |
Gene: TM1074: glycoside hydrolase family 2 sugar binding |
Gene: TRQ2_1743: glycoside hydrolase family 2 sugar binding |
Gene: CTN_1495: glycoside hydrolase family 2 sugar binding |
Gene: Tpet_1670: glycoside hydrolase family 2 sugar binding |
Gene: Tnap_1693: glycoside hydrolase family 2 sugar binding |
|
|
|
|
|
|
glycoside hydrolase family 2 sugar binding |
| CRON 3. | ||||||||||||
| rhaR |
*
Thermotoga maritima MSB8 Site: position = -71 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: TM1069: Predicted regulator of rhamnose utilization, DeoR family |
|
*
Thermotoga neapolitana DSM 4359 Site: position = -72 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: CTN_1500: Predicted regulator of rhamnose utilization, DeoR family |
*
Thermotoga petrophila RKU-1 Site: position = -29 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: Tpet_1675: Predicted regulator of rhamnose utilization, DeoR family |
*
Thermotoga naphthophila RKU-10 Site: position = -72 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: Tnap_1698: Predicted regulator of rhamnose utilization, DeoR family |
|
|
|
|
|
|
Predicted regulator of rhamnose utilization, DeoR family |
| agu4C |
Gene: TM1068: Alpha-glucuronidase (EC 3.2.1.139) |
|
Gene: CTN_1501: Alpha-glucuronidase (EC 3.2.1.139) |
Gene: Tpet_1676: Alpha-glucuronidase (EC 3.2.1.139) |
|
|
|
|
|
|
|
Alpha-glucuronidase (EC 3.2.1.139) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |