Regulog RhaR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - DeoR
By effector - Rhamnose
By pathway - Rhamnose utilization
By pathway - Rhamnose oligosaccharides utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	14	3
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359	12	3
Thermotoga petrophila RKU-1	21	3
Thermotoga naphthophila RKU-10	11	3
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
rtpE	* Thermotoga maritima MSB8 Site: position = -74 score = 6.06447 sequence = TGTTGATATTATATTGATAA Gene: TM1067: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component	Thermotoga sp. RQ2 Gene: TRQ2_0510: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component	2 Thermotoga neapolitana DSM 4359* Site: position = -54 score = 5.56873 sequence = TATTGATACTATATTGATAG Gene: CTN_1502: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Gene: CTN_1503: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component	2 Thermotoga petrophila RKU-1* Gene: Tpet_1687: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Site: position = -78 score = 5.67162 sequence = AGTTGATATCATATTGATAA Gene: Tpet_1677: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
Tpet_1678	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1678: FG-GAP repeat protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	FG-GAP repeat protein
aguE2	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1679: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein
aguF2	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1680: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1
aguG2	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1681: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2
ramA	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	* Thermotoga petrophila RKU-1 Site: position = -47 score = 5.3023 sequence = TTATGATAAATTTATGATCG Gene: Tpet_1682: alpha-L-rhamnosidase	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	alpha-L-rhamnosidase
rtpF	Thermotoga maritima MSB8 Gene: TM1066: Predicted rhamnose oligosaccharide ABC transporter, permease component 1	Thermotoga sp. RQ2 Gene: TRQ2_0509: Predicted rhamnose oligosaccharide ABC transporter, permease component 1	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1683: Predicted rhamnose oligosaccharide ABC transporter, permease component 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted rhamnose oligosaccharide ABC transporter, permease component 1
rtpG	Thermotoga maritima MSB8 Gene: TM1065: Predicted rhamnose oligosaccharide ABC transporter, permease component 2	Thermotoga sp. RQ2 Gene: TRQ2_0508: Predicted rhamnose oligosaccharide ABC transporter, permease component 2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1684: Predicted rhamnose oligosaccharide ABC transporter, permease component 2	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted rhamnose oligosaccharide ABC transporter, permease component 2
rtpK	Thermotoga maritima MSB8 Gene: TM1064: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2	Thermotoga sp. RQ2 Gene: TRQ2_0507: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1685: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
rtpL	Thermotoga maritima MSB8 Gene: TM1063: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1	Thermotoga sp. RQ2 Gene: TRQ2_0506: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_1686: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
bglJ	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1504: putative beta-glucosidase	Thermotoga petrophila RKU-1 Gene: Tpet_1688: putative beta-glucosidase	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	putative beta-glucosidase
gusB	Thermotoga maritima MSB8 Gene: TM1062: putative beta-glucuronidase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1505: putative beta-glucuronidase	Thermotoga petrophila RKU-1 Gene: Tpet_1689: putative beta-glucuronidase	Thermotoga naphthophila RKU-10 Gene: Tnap_1703: putative beta-glucuronidase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	putative beta-glucuronidase
TM1061	Thermotoga maritima MSB8 Gene: TM1061: putative unsaturated glucuronyl hydrolase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1506: putative unsaturated glucuronyl hydrolase	Thermotoga petrophila RKU-1 Gene: Tpet_1690: putative unsaturated glucuronyl hydrolase	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	putative unsaturated glucuronyl hydrolase
Tnap_1699	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	* Thermotoga naphthophila RKU-10 Site: position = -42 score = 5.71145 sequence = ATTAGATAAATTTATGATAA Gene: Tnap_1699: predicted rhamnose ABC transporter, ATP-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted rhamnose ABC transporter, ATP-binding protein
Tnap_1700	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10 Gene: Tnap_1700: predicted rhamnose ABC transporter, permease protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted rhamnose ABC transporter, permease protein
Tnap_1701	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10 Gene: Tnap_1701: predicted rhamnose ABC transporter, permease protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted rhamnose ABC transporter, permease protein
Tnap_1702	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10 Gene: Tnap_1702: predicted rhamnose ABC transporter, solute-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted rhamnose ABC transporter, solute-binding protein

CRON 2.
rhaM2	* Thermotoga maritima MSB8 Site: position = -56 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: TM1070: L-rhamnose mutarotase, alternative	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -57 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: CTN_1499: L-rhamnose mutarotase, alternative	* Thermotoga petrophila RKU-1 Site: position = -56 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: Tpet_1674: L-rhamnose mutarotase, alternative	* Thermotoga naphthophila RKU-10 Site: position = -57 score = 6.6572 sequence = TTGTGATTAATTTATGATAA Gene: Tnap_1697: L-rhamnose mutarotase, alternative	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	L-rhamnose mutarotase, alternative
rhaA	Thermotoga maritima MSB8 Gene: TM1071: Alternative L-rhamnose isomerase (EC 5.3.1.14)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1498: Alternative L-rhamnose isomerase (EC 5.3.1.14)	Thermotoga petrophila RKU-1 Gene: Tpet_1673: Alternative L-rhamnose isomerase (EC 5.3.1.14)	Thermotoga naphthophila RKU-10 Gene: Tnap_1696: Alternative L-rhamnose isomerase (EC 5.3.1.14)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alternative L-rhamnose isomerase (EC 5.3.1.14)
rhaD	Thermotoga maritima MSB8 Gene: TM1072: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)	Thermotoga sp. RQ2 Gene: TRQ2_1745: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)	Thermotoga neapolitana DSM 4359 Gene: CTN_1497: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)	Thermotoga petrophila RKU-1 Gene: Tpet_1672: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)	Thermotoga naphthophila RKU-10 Gene: Tnap_1695: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
rhaB	Thermotoga maritima MSB8 Gene: TM1073: Rhamnulokinase (EC 2.7.1.5)	Thermotoga sp. RQ2 Gene: TRQ2_1744: Rhamnulokinase (EC 2.7.1.5)	Thermotoga neapolitana DSM 4359 Gene: CTN_1496: Rhamnulokinase (EC 2.7.1.5)	Thermotoga petrophila RKU-1 Gene: Tpet_1671: Rhamnulokinase (EC 2.7.1.5)	Thermotoga naphthophila RKU-10 Gene: Tnap_1694: Rhamnulokinase (EC 2.7.1.5)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Rhamnulokinase (EC 2.7.1.5)
rhaC	Thermotoga maritima MSB8 Gene: TM1074: glycoside hydrolase family 2 sugar binding	Thermotoga sp. RQ2 Gene: TRQ2_1743: glycoside hydrolase family 2 sugar binding	Thermotoga neapolitana DSM 4359 Gene: CTN_1495: glycoside hydrolase family 2 sugar binding	Thermotoga petrophila RKU-1 Gene: Tpet_1670: glycoside hydrolase family 2 sugar binding	Thermotoga naphthophila RKU-10 Gene: Tnap_1693: glycoside hydrolase family 2 sugar binding	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	glycoside hydrolase family 2 sugar binding

CRON 3.
rhaR	* Thermotoga maritima MSB8 Site: position = -71 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: TM1069: Predicted regulator of rhamnose utilization, DeoR family	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -72 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: CTN_1500: Predicted regulator of rhamnose utilization, DeoR family	* Thermotoga petrophila RKU-1 Site: position = -29 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: Tpet_1675: Predicted regulator of rhamnose utilization, DeoR family	* Thermotoga naphthophila RKU-10 Site: position = -72 score = 4.4282 sequence = TTATCATAAATTAATCACAA Gene: Tnap_1698: Predicted regulator of rhamnose utilization, DeoR family	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted regulator of rhamnose utilization, DeoR family
agu4C	Thermotoga maritima MSB8 Gene: TM1068: Alpha-glucuronidase (EC 3.2.1.139)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_1501: Alpha-glucuronidase (EC 3.2.1.139)	Thermotoga petrophila RKU-1 Gene: Tpet_1676: Alpha-glucuronidase (EC 3.2.1.139)	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-glucuronidase (EC 3.2.1.139)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RhaR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --