Regulon of RhaR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1069
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Regulog:	RhaR - Thermotogales
Statistics of regulated genes:
- Genes	14
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - DeoR
By effector - Rhamnose
By pathway - Rhamnose utilization
By pathway - Rhamnose oligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.1 Sequence: TGTTGATATTATATTGATAA Locus tag: TM1067 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: TM1066 Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 Locus tag: TM1065 Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 Locus tag: TM1064 Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 Locus tag: TM1063 Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 Locus tag: TM1062 Name: gusB Funciton: putative beta-glucuronidase Locus tag: TM1061 Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase
	TM1067	rtpE	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
	TM1066	rtpF	Predicted rhamnose oligosaccharide ABC transporter, permease component 1
	TM1065	rtpG	Predicted rhamnose oligosaccharide ABC transporter, permease component 2
	TM1064	rtpK	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
	TM1063	rtpL	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
	TM1062	gusB	putative beta-glucuronidase
	TM1061	TM1061	putative unsaturated glucuronyl hydrolase
Position: -56 Score: 6.7 Sequence: TTGTGATTAATTTATGATAA Locus tag: TM1070 Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative Locus tag: TM1071 Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14) Locus tag: TM1072 Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) Locus tag: TM1073 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) Locus tag: TM1074 Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding
	TM1070	rhaM2	L-rhamnose mutarotase, alternative
	TM1071	rhaA	Alternative L-rhamnose isomerase (EC 5.3.1.14)
	TM1072	rhaD	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
	TM1073	rhaB	Rhamnulokinase (EC 2.7.1.5)
	TM1074	rhaC	glycoside hydrolase family 2 sugar binding
Position: -71 Score: 4.4 Sequence: TTATCATAAATTAATCACAA Locus tag: TM1069 Name: rhaR Funciton: Predicted regulator of rhamnose utilization, DeoR family Locus tag: TM1068 Name: agu4C Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	TM1069	rhaR	Predicted regulator of rhamnose utilization, DeoR family
	TM1068	agu4C	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD