Regulon of RhaR in Thermotoga petrophila RKU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Tpet_1675
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Regulog:	RhaR - Thermotogales
Statistics of regulated genes:
- Genes	21
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - DeoR
By effector - Rhamnose
By pathway - Rhamnose utilization
By pathway - Rhamnose oligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 5.7 Sequence: AGTTGATATCATATTGATAA Position: -47 Score: 5.3 Sequence: TTATGATAAATTTATGATCG Locus tag: Tpet_1677 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_1678 Name: null Funciton: FG-GAP repeat protein Locus tag: Tpet_1679 Name: aguE2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein Locus tag: Tpet_1680 Name: aguF2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1 Locus tag: Tpet_1681 Name: aguG2 Funciton: homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2 Locus tag: Tpet_1682 Name: ramA Funciton: alpha-L-rhamnosidase Locus tag: Tpet_1683 Name: rtpF Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 1 Locus tag: Tpet_1684 Name: rtpG Funciton: Predicted rhamnose oligosaccharide ABC transporter, permease component 2 Locus tag: Tpet_1685 Name: rtpK Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2 Locus tag: Tpet_1686 Name: rtpL Funciton: Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1 Locus tag: Tpet_1687 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: Tpet_1688 Name: bglJ Funciton: putative beta-glucosidase Locus tag: Tpet_1689 Name: gusB Funciton: putative beta-glucuronidase Locus tag: Tpet_1690 Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase
	Tpet_1677	rtpE	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
	Tpet_1678		FG-GAP repeat protein
	Tpet_1679	aguE2	homolog of alpha-1,4-digalacturonate ABC transporter, substrate-binding protein
	Tpet_1680	aguF2	homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 1
	Tpet_1681	aguG2	homolog of alpha-1,4-digalacturonate ABC transporter, permease protein 2
	Tpet_1682	ramA	alpha-L-rhamnosidase
	Tpet_1683	rtpF	Predicted rhamnose oligosaccharide ABC transporter, permease component 1
	Tpet_1684	rtpG	Predicted rhamnose oligosaccharide ABC transporter, permease component 2
	Tpet_1685	rtpK	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 2
	Tpet_1686	rtpL	Predicted rhamnose oligosaccharide ABC transporter, ATP-binding component 1
	Tpet_1687	rtpE	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
	Tpet_1688	bglJ	putative beta-glucosidase
	Tpet_1689	gusB	putative beta-glucuronidase
	Tpet_1690	TM1061	putative unsaturated glucuronyl hydrolase
Position: -56 Score: 6.7 Sequence: TTGTGATTAATTTATGATAA Locus tag: Tpet_1674 Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative Locus tag: Tpet_1673 Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14) Locus tag: Tpet_1672 Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) Locus tag: Tpet_1671 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) Locus tag: Tpet_1670 Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding
	Tpet_1674	rhaM2	L-rhamnose mutarotase, alternative
	Tpet_1673	rhaA	Alternative L-rhamnose isomerase (EC 5.3.1.14)
	Tpet_1672	rhaD	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
	Tpet_1671	rhaB	Rhamnulokinase (EC 2.7.1.5)
	Tpet_1670	rhaC	glycoside hydrolase family 2 sugar binding
Position: -29 Score: 4.4 Sequence: TTATCATAAATTAATCACAA Locus tag: Tpet_1675 Name: rhaR Funciton: Predicted regulator of rhamnose utilization, DeoR family Locus tag: Tpet_1676 Name: agu4C Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	Tpet_1675	rhaR	Predicted regulator of rhamnose utilization, DeoR family
	Tpet_1676	agu4C	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of RhaR in Thermotoga petrophila RKU-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --