Regulon of RhaR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_1698
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Regulog:	RhaR - Thermotogales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - DeoR
By effector - Rhamnose
By pathway - Rhamnose utilization
By pathway - Rhamnose oligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.7 Sequence: ATTAGATAAATTTATGATAA Locus tag: Tnap_1699 Name: Tnap_1699 Funciton: predicted rhamnose ABC transporter, ATP-binding protein Locus tag: Tnap_1700 Name: Tnap_1700 Funciton: predicted rhamnose ABC transporter, permease protein Locus tag: Tnap_1701 Name: Tnap_1701 Funciton: predicted rhamnose ABC transporter, permease protein Locus tag: Tnap_1702 Name: Tnap_1702 Funciton: predicted rhamnose ABC transporter, solute-binding protein Locus tag: Tnap_1703 Name: gusB Funciton: putative beta-glucuronidase
	Tnap_1699	Tnap_1699	predicted rhamnose ABC transporter, ATP-binding protein
	Tnap_1700	Tnap_1700	predicted rhamnose ABC transporter, permease protein
	Tnap_1701	Tnap_1701	predicted rhamnose ABC transporter, permease protein
	Tnap_1702	Tnap_1702	predicted rhamnose ABC transporter, solute-binding protein
	Tnap_1703	gusB	putative beta-glucuronidase
Position: -57 Score: 6.7 Sequence: TTGTGATTAATTTATGATAA Locus tag: Tnap_1697 Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative Locus tag: Tnap_1696 Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14) Locus tag: Tnap_1695 Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) Locus tag: Tnap_1694 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) Locus tag: Tnap_1693 Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding
	Tnap_1697	rhaM2	L-rhamnose mutarotase, alternative
	Tnap_1696	rhaA	Alternative L-rhamnose isomerase (EC 5.3.1.14)
	Tnap_1695	rhaD	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
	Tnap_1694	rhaB	Rhamnulokinase (EC 2.7.1.5)
	Tnap_1693	rhaC	glycoside hydrolase family 2 sugar binding
Position: -72 Score: 4.4 Sequence: TTATCATAAATTAATCACAA Locus tag: Tnap_1698 Name: rhaR Funciton: Predicted regulator of rhamnose utilization, DeoR family
	Tnap_1698	rhaR	Predicted regulator of rhamnose utilization, DeoR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD