Regulon of RhaR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_1500
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Rhamnose utilization; Rhamnose oligosaccharides utilization
Effector:	Rhamnose
Regulog:	RhaR - Thermotogales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - DeoR
By effector - Rhamnose
By pathway - Rhamnose utilization
By pathway - Rhamnose oligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.7 Sequence: TTGTGATTAATTTATGATAA Locus tag: CTN_1499 Name: rhaM2 Funciton: L-rhamnose mutarotase, alternative Locus tag: CTN_1498 Name: rhaA Funciton: Alternative L-rhamnose isomerase (EC 5.3.1.14) Locus tag: CTN_1497 Name: rhaD Funciton: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) Locus tag: CTN_1496 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) Locus tag: CTN_1495 Name: rhaC Funciton: glycoside hydrolase family 2 sugar binding
	CTN_1499	rhaM2	L-rhamnose mutarotase, alternative
	CTN_1498	rhaA	Alternative L-rhamnose isomerase (EC 5.3.1.14)
	CTN_1497	rhaD	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19)
	CTN_1496	rhaB	Rhamnulokinase (EC 2.7.1.5)
	CTN_1495	rhaC	glycoside hydrolase family 2 sugar binding
Position: -54 Score: 5.6 Sequence: TATTGATACTATATTGATAG Locus tag: CTN_1502 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_1503 Name: rtpE Funciton: Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component Locus tag: CTN_1504 Name: bglJ Funciton: putative beta-glucosidase Locus tag: CTN_1505 Name: gusB Funciton: putative beta-glucuronidase Locus tag: CTN_1506 Name: TM1061 Funciton: putative unsaturated glucuronyl hydrolase
	CTN_1502	rtpE	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
	CTN_1503	rtpE	Predicted rhamnose oligosaccharide ABC transporter, substrate-binding component
	CTN_1504	bglJ	putative beta-glucosidase
	CTN_1505	gusB	putative beta-glucuronidase
	CTN_1506	TM1061	putative unsaturated glucuronyl hydrolase
Position: -72 Score: 4.4 Sequence: TTATCATAAATTAATCACAA Locus tag: CTN_1500 Name: rhaR Funciton: Predicted regulator of rhamnose utilization, DeoR family Locus tag: CTN_1501 Name: agu4C Funciton: Alpha-glucuronidase (EC 3.2.1.139)
	CTN_1500	rhaR	Predicted regulator of rhamnose utilization, DeoR family
	CTN_1501	agu4C	Alpha-glucuronidase (EC 3.2.1.139)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD