Regulog ManR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Mannose
By pathway - Mannan and beta-mannosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	11	2
Thermotoga sp. RQ2	11	2
Thermotoga neapolitana DSM 4359	3	1
Thermotoga petrophila RKU-1	3	1
Thermotoga naphthophila RKU-10	4	1
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
manB	* Thermotoga maritima MSB8 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: TM1227: Endo-1,4-beta-mannosidase	* Thermotoga sp. RQ2 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: TRQ2_1591: Endo-1,4-beta-mannosidase	* Thermotoga neapolitana DSM 4359 Site: position = -38 score = 6.90233 sequence = AAATAAGTACAGATTACTAATTA Gene: CTN_1345: Endo-1,4-beta-mannosidase	* Thermotoga petrophila RKU-1 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: Tpet_1542: Endo-1,4-beta-mannosidase	* Thermotoga naphthophila RKU-10 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: Tnap_1565: Endo-1,4-beta-mannosidase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Endo-1,4-beta-mannosidase
manD	Thermotoga maritima MSB8 Gene: TM1226: Mannoside ABC transport system, sugar-binding protein	Thermotoga sp. RQ2 Gene: TRQ2_1592: Mannoside ABC transport system, sugar-binding protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10 Gene: Tnap_1566: Mannoside ABC transport system, sugar-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Mannoside ABC transport system, sugar-binding protein
manC	Thermotoga maritima MSB8 Gene: TM1225: Predicted mannobiose phosphorylase	Thermotoga sp. RQ2 Gene: TRQ2_1593: Predicted mannobiose phosphorylase	Thermotoga neapolitana DSM 4359 Gene: CTN_1346: Predicted mannobiose phosphorylase	Thermotoga petrophila RKU-1 Gene: Tpet_1543: Predicted mannobiose phosphorylase	Thermotoga naphthophila RKU-10 Gene: Tnap_1567: Predicted mannobiose phosphorylase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted mannobiose phosphorylase
manR	Thermotoga maritima MSB8 Gene: TM1224: Mannose-responsive regulator of mannose and mannoside utilization, ROK family	Thermotoga sp. RQ2 Gene: TRQ2_1594: Mannose-responsive regulator of mannose and mannoside utilization, ROK family	Thermotoga neapolitana DSM 4359 Gene: CTN_1347: Mannose-responsive regulator of mannose and mannoside utilization, ROK family	Thermotoga petrophila RKU-1 Gene: Tpet_1544: Mannose-responsive regulator of mannose and mannoside utilization, ROK family	Thermotoga naphthophila RKU-10 Gene: Tnap_1568: Mannose-responsive regulator of mannose and mannoside utilization, ROK family	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Mannose-responsive regulator of mannose and mannoside utilization, ROK family

CRON 2.
mtpE	* Thermotoga maritima MSB8 Site: position = -120 score = 4.51346 sequence = GAATAATTACTCTTCACTTCGTT Site: position = -50 score = 5.10739 sequence = TTATTAGTAAGTGTTATTTATTA Gene: TM1746: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein	* Thermotoga sp. RQ2 Site: position = -120 score = 4.51346 sequence = GAATAATTACTCTTCACTTCGTT Site: position = -50 score = 5.10739 sequence = TTATTAGTAAGTGTTATTTATTA Gene: TRQ2_1079: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein
mtpF	Thermotoga maritima MSB8 Gene: TM1747: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1	Thermotoga sp. RQ2 Gene: TRQ2_1078: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1
mtpG	Thermotoga maritima MSB8 Gene: TM1748: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2	Thermotoga sp. RQ2 Gene: TRQ2_1077: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2
mtpK	Thermotoga maritima MSB8 Gene: TM1749: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1	Thermotoga sp. RQ2 Gene: TRQ2_1076: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1
mtpL	Thermotoga maritima MSB8 Gene: TM1750: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2	Thermotoga sp. RQ2 Gene: TRQ2_1075: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2
cel5A	Thermotoga maritima MSB8 Gene: TM1751: Endoglucanase (EC 3.2.1.4)	Thermotoga sp. RQ2 Gene: TRQ2_1074: Endoglucanase (EC 3.2.1.4)	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Endoglucanase (EC 3.2.1.4)
cel5B	Thermotoga maritima MSB8 Gene: TM1752: Endo-mannanase (EC 3.2.1.78)	Thermotoga sp. RQ2 Gene: TRQ2_1073: Endo-mannanase (EC 3.2.1.78)	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Endo-mannanase (EC 3.2.1.78)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ManR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --