Regulog ManR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Mannan and beta-mannosides utilization |
| Effector: | Mannose |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - ROK
- By effector - Mannose
- By pathway - Mannan and beta-mannosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 11 | 2 |
| Thermotoga sp. RQ2 | 11 | 2 |
| Thermotoga neapolitana DSM 4359 | 3 | 1 |
| Thermotoga petrophila RKU-1 | 3 | 1 |
| Thermotoga naphthophila RKU-10 | 4 | 1 |
| Thermotoga lettingae TMO | ||
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| manB |
*
Thermotoga maritima MSB8 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: TM1227: Endo-1,4-beta-mannosidase |
*
Thermotoga sp. RQ2 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: TRQ2_1591: Endo-1,4-beta-mannosidase |
*
Thermotoga neapolitana DSM 4359 Site: position = -38 score = 6.90233 sequence = AAATAAGTACAGATTACTAATTA Gene: CTN_1345: Endo-1,4-beta-mannosidase |
*
Thermotoga petrophila RKU-1 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: Tpet_1542: Endo-1,4-beta-mannosidase |
*
Thermotoga naphthophila RKU-10 Site: position = -38 score = 7.45403 sequence = AAATAAGTAAAGTTTACTAATTA Gene: Tnap_1565: Endo-1,4-beta-mannosidase |
|
|
|
|
|
|
Endo-1,4-beta-mannosidase |
| manD |
Gene: TM1226: Mannoside ABC transport system, sugar-binding protein |
Gene: TRQ2_1592: Mannoside ABC transport system, sugar-binding protein |
|
|
Gene: Tnap_1566: Mannoside ABC transport system, sugar-binding protein |
|
|
|
|
|
|
Mannoside ABC transport system, sugar-binding protein |
| manC |
Gene: TM1225: Predicted mannobiose phosphorylase |
Gene: TRQ2_1593: Predicted mannobiose phosphorylase |
Gene: CTN_1346: Predicted mannobiose phosphorylase |
Gene: Tpet_1543: Predicted mannobiose phosphorylase |
Gene: Tnap_1567: Predicted mannobiose phosphorylase |
|
|
|
|
|
|
Predicted mannobiose phosphorylase |
| manR |
Gene: TM1224: Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
Gene: TRQ2_1594: Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
Gene: CTN_1347: Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
Gene: Tpet_1544: Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
Gene: Tnap_1568: Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
|
|
|
|
|
|
Mannose-responsive regulator of mannose and mannoside utilization, ROK family |
| CRON 2. | ||||||||||||
| mtpE |
*
Thermotoga maritima MSB8 Site: position = -120 score = 4.51346 sequence = GAATAATTACTCTTCACTTCGTT Site: position = -50 score = 5.10739 sequence = TTATTAGTAAGTGTTATTTATTA Gene: TM1746: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein |
*
Thermotoga sp. RQ2 Site: position = -120 score = 4.51346 sequence = GAATAATTACTCTTCACTTCGTT Site: position = -50 score = 5.10739 sequence = TTATTAGTAAGTGTTATTTATTA Gene: TRQ2_1079: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein |
|
|
|
|
|
|
|
|
|
Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein |
| mtpF |
Gene: TM1747: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 |
Gene: TRQ2_1078: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 |
| mtpG |
Gene: TM1748: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 |
Gene: TRQ2_1077: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 |
| mtpK |
Gene: TM1749: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 |
Gene: TRQ2_1076: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 |
|
|
|
|
|
|
|
|
|
Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 |
| mtpL |
Gene: TM1750: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 |
Gene: TRQ2_1075: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 |
|
|
|
|
|
|
|
|
|
Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 |
| cel5A |
Gene: TM1751: Endoglucanase (EC 3.2.1.4) |
Gene: TRQ2_1074: Endoglucanase (EC 3.2.1.4) |
|
|
|
|
|
|
|
|
|
Endoglucanase (EC 3.2.1.4) |
| cel5B |
Gene: TM1752: Endo-mannanase (EC 3.2.1.78) |
Gene: TRQ2_1073: Endo-mannanase (EC 3.2.1.78) |
|
|
|
|
|
|
|
|
|
Endo-mannanase (EC 3.2.1.78) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |