Regulon of ManR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1224
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Regulog:	ManR - Thermotogales
Statistics of regulated genes:
- Genes	11
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Mannose
By pathway - Mannan and beta-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.5 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: TM1227 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: TM1226 Name: manD Funciton: Mannoside ABC transport system, sugar-binding protein Locus tag: TM1225 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: TM1224 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
	TM1227	manB	Endo-1,4-beta-mannosidase
	TM1226	manD	Mannoside ABC transport system, sugar-binding protein
	TM1225	manC	Predicted mannobiose phosphorylase
	TM1224	manR	Mannose-responsive regulator of mannose and mannoside utilization, ROK family
Position: -120 Score: 4.5 Sequence: GAATAATTACTCTTCACTTCGTT Position: -50 Score: 5.1 Sequence: TTATTAGTAAGTGTTATTTATTA Locus tag: TM1746 Name: mtpE Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein Locus tag: TM1747 Name: mtpF Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 Locus tag: TM1748 Name: mtpG Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 Locus tag: TM1749 Name: mtpK Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 Locus tag: TM1750 Name: mtpL Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 Locus tag: TM1751 Name: cel5A Funciton: Endoglucanase (EC 3.2.1.4) Locus tag: TM1752 Name: cel5B Funciton: Endo-mannanase (EC 3.2.1.78)
	TM1746	mtpE	Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein
	TM1747	mtpF	Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1
	TM1748	mtpG	Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2
	TM1749	mtpK	Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1
	TM1750	mtpL	Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2
	TM1751	cel5A	Endoglucanase (EC 3.2.1.4)
	TM1752	cel5B	Endo-mannanase (EC 3.2.1.78)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD