Regulon of ManR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_1568
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Regulog:	ManR - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Mannose
By pathway - Mannan and beta-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.5 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: Tnap_1565 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: Tnap_1566 Name: manD Funciton: Mannoside ABC transport system, sugar-binding protein Locus tag: Tnap_1567 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: Tnap_1568 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
	Tnap_1565	manB	Endo-1,4-beta-mannosidase
	Tnap_1566	manD	Mannoside ABC transport system, sugar-binding protein
	Tnap_1567	manC	Predicted mannobiose phosphorylase
	Tnap_1568	manR	Mannose-responsive regulator of mannose and mannoside utilization, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD