Orthologous regulated operons containing mtpE gene

Properties
Regulog:	ManR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Phylum:	Thermotogae

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -120 Score: 4.51346 Sequence: GAATAATTACTCTTCACTTCGTT Position: -50 Score: 5.10739 Sequence: TTATTAGTAAGTGTTATTTATTA Locus tag: TM1746 Name: mtpE Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein Locus tag: TM1747 Name: mtpF Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 Locus tag: TM1748 Name: mtpG Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 Locus tag: TM1749 Name: mtpK Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 Locus tag: TM1750 Name: mtpL Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 Locus tag: TM1751 Name: cel5A Funciton: Endoglucanase (EC 3.2.1.4) Locus tag: TM1752 Name: cel5B Funciton: Endo-mannanase (EC 3.2.1.78)
mtpE-mtpF-mtpG-mtpK-mtpL-cel5A-cel5B	-120	4.5	GAATAATTACTCTTCACTTCGTT	TM1746
	-50	5.1	TTATTAGTAAGTGTTATTTATTA
Thermotoga sp. RQ2
Position: -120 Score: 4.51346 Sequence: GAATAATTACTCTTCACTTCGTT Position: -50 Score: 5.10739 Sequence: TTATTAGTAAGTGTTATTTATTA Locus tag: TRQ2_1079 Name: mtpE Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, periplasmic oligopeptide-binding protein Locus tag: TRQ2_1078 Name: mtpF Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 1 Locus tag: TRQ2_1077 Name: mtpG Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, permease protein 2 Locus tag: TRQ2_1076 Name: mtpK Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 1 Locus tag: TRQ2_1075 Name: mtpL Funciton: Beta-mannan and fructose induced hypothetical ABC transporter, ATP-binding protein 2 Locus tag: TRQ2_1074 Name: cel5A Funciton: Endoglucanase (EC 3.2.1.4) Locus tag: TRQ2_1073 Name: cel5B Funciton: Endo-mannanase (EC 3.2.1.78)
mtpE-mtpF-mtpG-mtpK-mtpL-cel5A-cel5B	-120	4.5	GAATAATTACTCTTCACTTCGTT	TRQ2_1079
	-50	5.1	TTATTAGTAAGTGTTATTTATTA