Regulon of ManR in Thermotoga petrophila RKU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Tpet_1544
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Regulog:	ManR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Mannose
By pathway - Mannan and beta-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.5 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: Tpet_1542 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: Tpet_1543 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: Tpet_1544 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
	Tpet_1542	manB	Endo-1,4-beta-mannosidase
	Tpet_1543	manC	Predicted mannobiose phosphorylase
	Tpet_1544	manR	Mannose-responsive regulator of mannose and mannoside utilization, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD