Regulog HcpR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By trascription factor - HcpR
- By TF family - CRP
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 2 | 2 |
| Thermotoga sp. RQ2 | 2 | 2 |
| Thermotoga neapolitana DSM 4359 | 1 | 1 |
| Thermotoga petrophila RKU-1 | 2 | 2 |
| Thermotoga naphthophila RKU-10 | 2 | 2 |
| Thermotoga lettingae TMO | 2 | 2 |
| Thermosipho africanus TCF52B | 2 | 2 |
| Thermosipho melanesiensis BI429 | 2 | 1 |
| Fervidobacterium nodosum Rt17-B1 | 2 | 2 |
| Petrotoga mobilis SJ95 | 2 | 2 |
| Thermotogales bacterium TBF 19.5.1 | 3 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| hcpR |
*
Thermotoga maritima MSB8 Site: position = -28 score = 6.52216 sequence = TCTGTAACAATTGTTACGGG Gene: TM1171: Transcriptional regulator HcpR, Crp/Fnr family |
*
Thermotoga sp. RQ2 Site: position = -31 score = 6.67411 sequence = TCCGTAACAATTGTTACGGG Gene: TRQ2_1644: Transcriptional regulator HcpR, Crp/Fnr family |
Gene: CTN_1404: Transcriptional regulator HcpR, Crp/Fnr family |
*
Thermotoga petrophila RKU-1 Site: position = -28 score = 6.2757 sequence = TCTGTAACAATTGTTACGAG Gene: Tpet_1578: Transcriptional regulator HcpR, Crp/Fnr family |
*
Thermotoga naphthophila RKU-10 Site: position = -28 score = 6.2757 sequence = TCTGTAACAATTGTTACGAG Gene: Tnap_1598: Transcriptional regulator HcpR, Crp/Fnr family |
*
Thermotoga lettingae TMO Site: position = -20 score = 5.57334 sequence = GCGGTAACATATGATACAGA Gene: Tlet_1357: Transcriptional regulator HcpR, Crp/Fnr family |
Gene: THA_1108: Transcriptional regulator HcpR, Crp/Fnr family |
Gene: Tmel_0756: Transcriptional regulator HcpR, Crp/Fnr family |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -229 score = 6.52625 sequence = TCCGTAACCTATGTTACGGA Gene: Fnod_1303: Transcriptional regulator HcpR, Crp/Fnr family |
*
Petrotoga mobilis SJ95 Site: position = -52 score = 6.23237 sequence = TCAGTAACAAATGTTACGCA Gene: Pmob_1162: Transcriptional regulator HcpR, Crp/Fnr family |
*
Thermotogales bacterium TBF 19.5.1 Site: position = -28 score = 6.56995 sequence = TCGGTAACATATGTTACGGA Gene: Kole_1156: Transcriptional regulator HcpR, Crp/Fnr family |
Transcriptional regulator HcpR, Crp/Fnr family |
| CRON 2. | ||||||||||||
| ytfE |
|
|
|
|
|
|
Gene: THA_1028: Regulator of cell morphogenesis and NO signaling |
*
Thermosipho melanesiensis BI429 Site: position = -59 score = 5.91973 sequence = AGCGTAACATAAGTTACGGA Gene: Tmel_0755: Regulator of cell morphogenesis and NO signaling |
|
|
*
Thermotogales bacterium TBF 19.5.1 Site: position = -86 score = 6.56995 sequence = TCCGTAACATATGTTACCGA Gene: Kole_1155: Regulator of cell morphogenesis and NO signaling |
Regulator of cell morphogenesis and NO signaling |
| hcp |
*
Thermotoga maritima MSB8 Site: position = -87 score = 6.52216 sequence = CCCGTAACAATTGTTACAGA Gene: TM1172: Hydroxylamine reductase (EC 1.7.-.-) |
*
Thermotoga sp. RQ2 Site: position = -80 score = 6.67411 sequence = CCCGTAACAATTGTTACGGA Gene: TRQ2_1643: Hydroxylamine reductase (EC 1.7.-.-) |
*
Thermotoga neapolitana DSM 4359 Site: position = -50 score = 6.67411 sequence = CCCGTAACAATTGTTACGGA Gene: CTN_1403: Hydroxylamine reductase (EC 1.7.-.-) |
*
Thermotoga petrophila RKU-1 Site: position = -81 score = 6.2757 sequence = CTCGTAACAATTGTTACAGA Gene: Tpet_1577: Hydroxylamine reductase (EC 1.7.-.-) |
*
Thermotoga naphthophila RKU-10 Site: position = -81 score = 6.2757 sequence = CTCGTAACAATTGTTACAGA Gene: Tnap_1597: Hydroxylamine reductase (EC 1.7.-.-) |
*
Thermotoga lettingae TMO Site: position = -79 score = 5.7091 sequence = TTCGTAACAAAAGTTACTGT Gene: Tlet_0222: Hydroxylamine reductase (EC 1.7.-.-) |
*2
Thermosipho africanus TCF52B Site: position = -79 score = 6.12784 sequence = TTCGTAACCTATGTTACAGA Gene: THA_824: Hydroxylamine reductase (EC 1.7.-.-) Site: position = -84 score = 6.42599 sequence = TCCGTAACTAATGTTACAGA Gene: THA_1919: Hydroxylamine reductase (EC 1.7.-.-) |
Gene: Tmel_0754: Hydroxylamine reductase (EC 1.7.-.-) |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -92 score = 6.52625 sequence = TCCGTAACATAGGTTACGGA Gene: Fnod_1302: Hydroxylamine reductase (EC 1.7.-.-) |
*
Petrotoga mobilis SJ95 Site: position = -132 score = 6.23237 sequence = TGCGTAACATTTGTTACTGA Gene: Pmob_1163: Hydroxylamine reductase (EC 1.7.-.-) |
Gene: Kole_1154: Hydroxylamine reductase (EC 1.7.-.-) |
Hydroxylamine reductase (EC 1.7.-.-) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |