Regulon of HcpR in Thermotoga sp. RQ2

Properties
Regulator type:	Transcription factor
TF locus tag:	TRQ2_1644
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	HcpR - Thermotogales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HcpR
By TF family - CRP
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 6.7 Sequence: CCCGTAACAATTGTTACGGA Locus tag: TRQ2_1643 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
	TRQ2_1643	hcp	Hydroxylamine reductase (EC 1.7.-.-)
Position: -31 Score: 6.7 Sequence: TCCGTAACAATTGTTACGGG Locus tag: TRQ2_1644 Name: hcpR Funciton: Transcriptional regulator HcpR, Crp/Fnr family
	TRQ2_1644	hcpR	Transcriptional regulator HcpR, Crp/Fnr family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD