Regulon of HcpR in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_0756
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	HcpR - Thermotogales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HcpR
By TF family - CRP
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.9 Sequence: AGCGTAACATAAGTTACGGA Locus tag: Tmel_0755 Name: ytfE Funciton: Regulator of cell morphogenesis and NO signaling Locus tag: Tmel_0754 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
	Tmel_0755	ytfE	Regulator of cell morphogenesis and NO signaling
	Tmel_0754	hcp	Hydroxylamine reductase (EC 1.7.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD