Regulon of HcpR in Thermotoga neapolitana DSM 4359
| Regulator type: | Transcription factor |
| TF locus tag: | CTN_1404 |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Regulog: | HcpR - Thermotogales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By trascription factor - HcpR
- By TF family - CRP
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -50
Score: 6.7 Sequence: CCCGTAACAATTGTTACGGA
Locus tag: CTN_1403
Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) |
|||
|
hcp
|
Hydroxylamine reductase (EC 1.7.-.-)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |