Regulon of HcpR in Thermotogales bacterium TBF 19.5.1

Properties
Regulator type:	Transcription factor
TF locus tag:	Kole_1156
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	HcpR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - HcpR
By TF family - CRP
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 6.6 Sequence: TCGGTAACATATGTTACGGA Locus tag: Kole_1156 Name: hcpR Funciton: Transcriptional regulator HcpR, Crp/Fnr family
	Kole_1156	hcpR	Transcriptional regulator HcpR, Crp/Fnr family
Position: -86 Score: 6.6 Sequence: TCCGTAACATATGTTACCGA Locus tag: Kole_1155 Name: ytfE Funciton: Regulator of cell morphogenesis and NO signaling Locus tag: Kole_1154 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
	Kole_1155	ytfE	Regulator of cell morphogenesis and NO signaling
	Kole_1154	hcp	Hydroxylamine reductase (EC 1.7.-.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD